Production of agartose -4, 6

A manufacturing method, a new technology of agar oligosaccharides, applied in the field of agar oligosaccharides, can solve the problems of poor specificity, high price, low activity, etc., and achieve the effect of mild conditions, low cost, and short action time

Inactive Publication Date: 2004-02-04
OCEAN UNIV OF CHINA
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low activity and poor specificity of the agarase obtained from marine microorganisms, it has seriously hindered the research on the structure-activity relationship of agarose compounds and the in-depth development of further application development.
So far, only β-agarase (Morrice, 1983) isolated from Pseudomonas atlantica has been industrialized, but the cost of producing new agar oligosaccharides with it is high and expensive, and its application range is limited to scientific research. Greatly hindered the development and application of agar oligosaccharides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0007] 1 Construction of Escherichia coli recombinant strain DH5α-pET24-agaA capable of highly expressing agarase

[0008] The upstream primer (5'GGAATTCCATATGAAAGGATTCACTAAG3') and the downstream primer (5'CCGCTCGAGCTGGAATTTAAAACGTTG3') were designed according to the complete sequence of the agarase gene agaA, the total DNA of Pseudomonas CY24 was used as a template, and the complete agarase gene was amplified by PCR. sequence. The PCR conditions were as follows: pre-denaturation at 94°C for 3 minutes, followed by 30 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 60s, and finally extension at 72°C for 10 minutes. Agarose electrophoresis showed a specific band at 1.36kb, which was excised from the agarose gel and ligated with the Escherichia coli expression vector pET-24a(+), and the ligated product was transferred into In Escherichia coli E. coli DH5α, transformants having ampicillin resistance were selected. The plasmid was extracted by a standard alkaline lysis method...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A process for preparing neoagarotetraose or neoagarohexaose includes such steps as hydrolyzing the agarose to obtain different types of neoagaroligose, and chromatographic separating to obtain the products with different degrees of polymerization. It features that the transgenic agarase used for said hydrolysis is exprssed by recombinant colibacillus DH5alpha-pET24-agaA. Its advantages are short period and low cost.

Description

technical field [0001] The invention relates to an agar oligosaccharide, in particular to a method for producing a new agar tetra-hexasaccharide. Background technique [0002] The main chain of agar is composed of 1,3-linked β-D-galactopyranose and 1,4-linked 3,6-endether-α-L-galactopyranose, which are alternately linked repeatedly. In recent years, with the rapid development of glycobiology and chemical research, it has been found that agar oligosaccharides with different degrees of polymerization have important medicinal value, such as anti-tumor, anti-aging, prevention of diabetes, etc., and are expected to develop into a new generation of marine drug. The traditional method of preparing agar oligosaccharides is the chemical dilute acid hydrolysis of agar. The conditions of this method are not easy to control, and the molecular weight of the cracked products is not uniform, and the yield of pure oligosaccharides is not high. The specificity of the substrate of the agara...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/00C12P19/04
Inventor于文功李京宝褚艳韩峰路新枝宫倩红
OwnerOCEAN UNIV OF CHINA