Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant fusion protein of mycobacterium tuberculosis Ag85B antigen and human IL-2, and its uses

A technology of mycobacterium tuberculosis and fusion protein, which is applied in the field of drugs or protein vaccines for the treatment of bladder tumors and the prevention of its recurrence, can solve the problems of large dosage of bladder cancer, large toxic and side effects, and long course of treatment, etc., and achieve prolongation of action time, toxicity The effect of reducing side effects and reducing clinical dosage

Inactive Publication Date: 2004-11-10
INST OF FIELD OPERATION SURGERY NO 3 MILITARY MEDICL UNIV PLA
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Whether it is BCG or IL-2 in the clinical treatment of bladder cancer, there are disadvantages such as large dose, long course of treatment, and large toxic and side effects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fusion protein of mycobacterium tuberculosis Ag85B antigen and human IL-2, and its uses
  • Recombinant fusion protein of mycobacterium tuberculosis Ag85B antigen and human IL-2, and its uses
  • Recombinant fusion protein of mycobacterium tuberculosis Ag85B antigen and human IL-2, and its uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Obtaining the Coding Gene of Ag85B Antigen of Mycobacterium Tuberculosis (Edman Strain)

[0065] Mycobacterium tuberculosis (Edman strain) was obtained from the Institute of Basic Medical Sciences, Shandong Academy of Medical Sciences. 7H9 liquid medium was used to culture Mycobacterium tuberculosis at a temperature of 37°C. After 2 weeks, the culture was centrifuged to collect the bacteria, and the genomic DNA of Mycobacterium tuberculosis was extracted from it.

[0066] The method for extracting Mycobacterium tuberculosis genomic DNA refers to the book Molecular clonging (J. Sambrook, Isolation of high-molecular-weight DNA from mammalian cells, 9.16-9.22, Cold Spring Harbor Laboratory Press, Molecular cloning, 1989).

[0067] The Ag85B structural gene was amplified from the genomic DNA of Mycobacterium tuberculosis by PCR. The 5' end primer sequence used is: 5'CGGAATTCTTCTCCCGGCCG 3' (SEQ ID NO: 5); the 3' end primer sequence is 5'GGGGTACCAGAGCCTCCGCCACC GCCGGCGCCTAA...

Embodiment 2

[0081] Obtaining the coding gene of human IL-2

[0082] Total RNA was extracted from mitogen-stimulated human Jurkat T lymphoma cells (from the Institute of Cells, Chinese Academy of Sciences), and the extraction method was carried out according to the RNA extraction kit of Shanghai Sangon Company. The cDNA of human Jurkat T cell tumor was obtained by RT-PCR.

[0083] The gene encoding human IL-2 was amplified from the above cDNA by PCR method. The 5' end primer sequence used is: 5'GG GGTACCGCACCTACTTC 3' (SEQ ID NO: 7); the 3' end primer sequence is 5'CGGGATCCTCAAGTCAGTGT 3' (SEQ ID NO: 8)

[0084] The PCR operating procedure is: add the following reaction reagents in a 50ul microcentrifuge tube:

[0085] Template DNA 1ul

[0086] 10×PCR buffer (containing magnesium chloride) 5ul

[0087] dNTPs (10mmol / L) 4ul

[0088] 1ul each of 5' and 3' primers (0.01mmol / L)

[0089] TaqDNA polymer (5u / ul) 1ul

[0090] Add deionized water to a final volume of 50ul

[0091] Reaction ...

Embodiment 3

[0097] Construct Ag85B-IL-2 prokaryotic expression plasmid: pG-Ag85B / IL-2.

[0098] Use KpnI+BamHI to digest pUC18-IL-2, recover the IL-2 gene fragment from the gel, and connect it to the pUC18-Ag85B plasmid that was also digested with KpnI+BamHI. The enzyme digestion, ligation, transformation and screening of recombinant clones were carried out according to Molecular clonging is carried out. The plasmid pUC-Ag85B / IL-2 containing Ag85B / IL-2 fusion gene was constructed.

[0099] Refer to Figure 5 for the identification results of restriction endonuclease digestion of plasmid pUC-Ag85B / IL-2.

[0100] The plasmid pU-Ag85B / IL-2 was digested with EcoRI+SalI double enzymes, the Ag85B / IL-2 fusion gene fragment was recovered from the gel, and it was connected with the pGEX4T-1 plasmid (purchased from Promega Company) that was also digested with EcoRI+SalI double enzymes to construct Prokaryotic expression plasmid pG-Ag85B / IL-2 containing Ag85B / IL-2 fusion gene.

[0101] Refer to Fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an Ag85B / IL-2 fusion protein through gene engineering recombination, wherein the fusion protein is fused from M. tuberculosis Ag85B antigen or Ag85B antigen in other mycobacterium with human IL-2. The invention also provides the genes for encoding the recombination fusion protein, which possesses the functions of activating immunocyte and improving body antineoplastic immunological reaction, thus can be used in preparing medicament for immunization therapy of tumor, especially suitable for preparing medicament or protein vaccine for treating bladder tumor and preventing its recurrence.

Description

technical field [0001] The present invention relates to a genetically engineered recombinant protein: Ag85B / IL-2 fusion protein, and its use in the preparation of drugs or protein vaccines for tumor immunotherapy, especially bladder tumor treatment and prevention of recurrence. technical background: [0002] Bladder tumor is the most common tumor in the urinary system, with clinical characteristics such as high incidence, easy invasion, metastasis, and recurrence. [0003] Bacillus Calmette-Guerin (BCG), as a live attenuated Mycobacterium bovis, is an effective biological immune modifier. Since Merales et al first reported the application of BCG in the treatment of bladder cancer in 1976 (Morales A, et al. Intracavitary Bacillus Calmette-Guerin in the treatment of superficial bladder tumors. J Urol 1976Aug; 116(2): 180-183), practice over the years Confirmed: intravesical infusion of BCG immunoprevention and treatment of superficial bladder tumors is a successful immunother...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/20A61K39/04A61P35/00C07K19/00C12N15/62C12N15/63
Inventor 靳凤烁杨登科
Owner INST OF FIELD OPERATION SURGERY NO 3 MILITARY MEDICL UNIV PLA