Recombinant fusion protein of mycobacterium tuberculosis Ag85B antigen and human IL-2, and its uses
A technology of mycobacterium tuberculosis and fusion protein, which is applied in the field of drugs or protein vaccines for the treatment of bladder tumors and the prevention of its recurrence, can solve the problems of large dosage of bladder cancer, large toxic and side effects, and long course of treatment, etc., and achieve prolongation of action time, toxicity The effect of reducing side effects and reducing clinical dosage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Obtaining the Coding Gene of Ag85B Antigen of Mycobacterium Tuberculosis (Edman Strain)
[0065] Mycobacterium tuberculosis (Edman strain) was obtained from the Institute of Basic Medical Sciences, Shandong Academy of Medical Sciences. 7H9 liquid medium was used to culture Mycobacterium tuberculosis at a temperature of 37°C. After 2 weeks, the culture was centrifuged to collect the bacteria, and the genomic DNA of Mycobacterium tuberculosis was extracted from it.
[0066] The method for extracting Mycobacterium tuberculosis genomic DNA refers to the book Molecular clonging (J. Sambrook, Isolation of high-molecular-weight DNA from mammalian cells, 9.16-9.22, Cold Spring Harbor Laboratory Press, Molecular cloning, 1989).
[0067] The Ag85B structural gene was amplified from the genomic DNA of Mycobacterium tuberculosis by PCR. The 5' end primer sequence used is: 5'CGGAATTCTTCTCCCGGCCG 3' (SEQ ID NO: 5); the 3' end primer sequence is 5'GGGGTACCAGAGCCTCCGCCACC GCCGGCGCCTAA...
Embodiment 2
[0081] Obtaining the coding gene of human IL-2
[0082] Total RNA was extracted from mitogen-stimulated human Jurkat T lymphoma cells (from the Institute of Cells, Chinese Academy of Sciences), and the extraction method was carried out according to the RNA extraction kit of Shanghai Sangon Company. The cDNA of human Jurkat T cell tumor was obtained by RT-PCR.
[0083] The gene encoding human IL-2 was amplified from the above cDNA by PCR method. The 5' end primer sequence used is: 5'GG GGTACCGCACCTACTTC 3' (SEQ ID NO: 7); the 3' end primer sequence is 5'CGGGATCCTCAAGTCAGTGT 3' (SEQ ID NO: 8)
[0084] The PCR operating procedure is: add the following reaction reagents in a 50ul microcentrifuge tube:
[0085] Template DNA 1ul
[0086] 10×PCR buffer (containing magnesium chloride) 5ul
[0087] dNTPs (10mmol / L) 4ul
[0088] 1ul each of 5' and 3' primers (0.01mmol / L)
[0089] TaqDNA polymer (5u / ul) 1ul
[0090] Add deionized water to a final volume of 50ul
[0091] Reaction ...
Embodiment 3
[0097] Construct Ag85B-IL-2 prokaryotic expression plasmid: pG-Ag85B / IL-2.
[0098] Use KpnI+BamHI to digest pUC18-IL-2, recover the IL-2 gene fragment from the gel, and connect it to the pUC18-Ag85B plasmid that was also digested with KpnI+BamHI. The enzyme digestion, ligation, transformation and screening of recombinant clones were carried out according to Molecular clonging is carried out. The plasmid pUC-Ag85B / IL-2 containing Ag85B / IL-2 fusion gene was constructed.
[0099] Refer to Figure 5 for the identification results of restriction endonuclease digestion of plasmid pUC-Ag85B / IL-2.
[0100] The plasmid pU-Ag85B / IL-2 was digested with EcoRI+SalI double enzymes, the Ag85B / IL-2 fusion gene fragment was recovered from the gel, and it was connected with the pGEX4T-1 plasmid (purchased from Promega Company) that was also digested with EcoRI+SalI double enzymes to construct Prokaryotic expression plasmid pG-Ag85B / IL-2 containing Ag85B / IL-2 fusion gene.
[0101] Refer to Fi...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap