Exiguobacterium sp. MY02 strain pyrimidine nucleoside phosphorylase gene and its preparation method

A pyrimidine nucleoside phosphorylase gene and technology of pyrimidine nucleoside phosphorylase, applied in the field of pyrimidine nucleoside phosphorylase gene, can solve the problems of unsuitable industrial production and low transferase activity

Inactive Publication Date: 2006-07-12
MIANYANG TEACHERS COLLEGE
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the reported transferase activity of various pyrimidine nucleoside phosphorylases is not high enough to meet the needs of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exiguobacterium sp. MY02 strain pyrimidine nucleoside phosphorylase gene and its preparation method
  • Exiguobacterium sp. MY02 strain pyrimidine nucleoside phosphorylase gene and its preparation method
  • Exiguobacterium sp. MY02 strain pyrimidine nucleoside phosphorylase gene and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0174] Example 1: Cloning and sequencing of pyrimidine nucleoside phosphorylase gene

[0175] The genomic DNA library of the Exiguobacterium sp.MY02 strain was screened by PCR technology, and the unknown pyrimidine nucleoside phosphorylase gene was cloned. The specific operation was: in Luria-Bertani (LB) medium containing 1% NaCl weight percentage concentration The Exiguobacterium sp.MY02 was cultured to the end logarithmic phase, and the genomic DNA was extracted. The genomic DNA was digested with Sau3A I, electrophoresed on agarose gel, and a 5-8 kb fragment was recovered, which was ligated with the pUC18 plasmid fragment completely digested with BamH I and dephosphorylated. Then, the ligation product was transferred into Escherichia coli DH5α competent cells according to the standard calcium chloride method, and cultured on LB solid medium (containing ampicillin, X-gal, IPTG). Pick out white spot recombinant colonies, culture them in LB liquid medium (containing ampicilli...

Embodiment 2

[0176] Embodiment 2: Construction of Escherichia coli expression vector

[0177] The upstream primer (5'GCACCATGGTAA TGCGTATGGTAGATTTG3') and the downstream primer (5'CCGTCTAGAAAATTGAATGACAGCGTGGAC') were designed according to the obtained pyrimidine nucleoside phosphorylase gene sequence, and the complete sequence of the pyrimidine nucleoside phosphorylase gene was obtained by PCR amplification. The PCR conditions were as follows: pre-denaturation at 94°C for 2 minutes, followed by 30 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 90s, and finally extension at 72°C for 10 minutes. Agarose gel electrophoresis showed a specific band at 1.3 kb, which was excised from the agarose gel, digested with Nco I and Xba I, and a 1.3 kb DNA fragment was recovered after agarose gel electrophoresis.

[0178] The Escherichia coli expression vector pBAD gIII / A was also digested with Nco I and Xba I, separated by agarose electrophoresis, and a 4.1kb DNA fragment was recovered, which was li...

Embodiment 3

[0179] Example 3: Construction of an Escherichia coli engineering strain capable of highly expressing pyrimidine nucleoside phosphorylase

[0180] The expression vector pPNP-A was transformed into Escherichia coli Top10F' according to the standard calcium chloride method, and the transformant with ampicillin resistance was screened. The plasmid was extracted by a standard alkaline lysis method, and two fragments of 1.3kb and 4.1kb were obtained by digestion with NcoI and XbaI, which were respectively the same size as the pyrimidine nucleoside phosphorylase gene and the expression vector pBAD gIII / A, proving that the highly efficient Escherichia coli recombinant strain pLyase-A / Top10F' expressing pyrimidine nucleoside phosphorylase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a structure gene of pyrimidine nucleoside phosphorylase which is characterized in that its coder is Exiguobacterium sp.MY02. When preparing for the gene, it first uses PCR method to sieve the gene group DNA base of the Exiguobacterium sp.MY02 strain and measures the sequence to ascertain the gene sequence of the pyrimidine nucleoside phosphorylase; it recombines the gene, purifies the recombining enzyme and measuring the activity in bacillus coli so that the result expresses that the pyrimidine nucleoside phosphorylase can coding generate recombining pyrimidine nucleoside phosphorylase with phosphorylation activity and higher transfer enzyme activity.

Description

technical field [0001] The invention relates to a pyrimidine nucleoside phosphorylase gene of an Exiguobacterium sp. MY02 strain and a method for preparing the pyrimidine nucleoside phosphorylase gene by using the Exiguobacterium sp. MY02 strain. Background technique [0002] In the past thirty years, nucleoside active substances (including natural structural bases, nucleosides, nucleotide structural analogs and polymers) that play an important role in metabolism are indispensable for the treatment of viruses, tumors, AIDS, etc. There are thousands of nucleoside antiviral compounds developed at present. 5'-deoxy-5-fluorouridine (5'-deoxy-5-fluorouridine, 5'-dFUrd) is a good new anti-tumor drug, which was officially used in clinical practice in my country in 1995, with good clinical effect and high market demand At present, it is mainly produced in large quantities by chemical synthesis. However, in the chemical production process: (1) at first the base and some groups of ri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/34C12N15/11C07H21/04C12N15/10C12N15/55
Inventor阮期平韩文君古静燕赵丽
OwnerMIANYANG TEACHERS COLLEGE