Beta-mannase gene and amino acid sequence of its coded product and preparation method

A technology of mannanase and enzyme gene is applied in the field of amino acid sequence and preparation of acid β-mannanase gene and its encoded product to achieve the effect of expanding gene resources

A technology of mannanase and enzyme gene is applied in the field of amino acid sequence and preparation of acid β-mannanase gene and its encoded product to achieve the effect of expanding gene resources

CN1807644AInactive Publication Date: 2006-07-26JINAN UNIVERSITY

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Cloning of β-mannanase gene

[0049] The total RNA of highly active Armillariella tabescens induced by konjac powder was extracted, and the β-mannanase sequences of 4 species with close relatives to fungi were retrieved from the Genebank protein database. The species were: Agaricus bisporus ), Aspergillus fumigatus Af293 (Aspergillus fumigatus), Aspergillus aculeatus (Aspergillus aculeatus), Hypocrea jecorina or Trichodermareesei (Trichoderma reesei), after multiple sequence alignment software clustalx analysis, the conserved region between the sequences was obtained, and then input into the block make (Protein Classification and Homology Database) analyzes the conserved regions of amino acid sequences without gaps; finally, use the primer design software CodeHop (Consensus Degenerate Hybrid Oligonucleotide Primers) to design multiple pairs of degenerate primers for these conserved regions, and use one pair of degenerate primers Use primers (5'GGTCCGGTGCTAGGC...

Embodiment 2

[0050] Example 2: Construction of high-copy recombinant expression plasmid pPICZαA-M

[0051] Referring to the enzyme cutting site of the pPICZαA vector, remove the signal peptide sequence from the cDNA sequence of the β-mannanase gene, add EcoRI and KpnI enzyme cutting sites, and add CAC CACCAC CAC CAC CAC (6His) before the stop codon TAG For full-length PCR, the primers are (5'CCGGAATTCGCTGTTCCTGAGTGGGGCCAATG3'; 5'CGGGGTACCCTAGTGGTGGTGGTGGTGGTGCGCCCGCGCTTTCAATGTAAC3'), the amplification conditions are denatured at 94°C for 4min, the first cycle is 94°C for 45s, 70°C for 45s, 72°C for 3min, and the annealing temperature for each subsequent cycle Decrease 1°C, a total of 5 cycles. Then perform 25 cycles of 94°C for 45s, 65°C for 45s, 72°C for 3min, and finally 72°C for 5min to amplify a fragment with a size of about 1300bp. The sequencing results show that the fragment size obtained is 1308bp consistent with the spliced ​​sequence.

Embodiment 3

[0052] Example 3: High expression of β-mannanase in Pichia pastoris GS115

[0053] The recombinant expression plasmid pPICZαA-M was single-digested with Sac I, electrotransformed into Pichia pastoris GS115, and the histidine-tagged β-mannanase was recombinantly expressed. All have growth on the plate containing the zeocin of 100ug / ml, 500ug / ml, 1000ug / ml respectively, pick single bacterium colony plate culture respectively, through 1% methanol induction, recombinant bacterium GS115-pPICZαA-M is in the konjac powder containing Obvious hydrolysis circles appeared on the plates, showing highly active β-mannanase. Recombinant bacteria GS115-pPICZαA-M grown on zeocin of 100ug / ml, 500ug / ml, and 1000ug / ml were respectively picked and cultured overnight in 25ml / 250ml of BMGY medium at 28-30°C and 220-270 rpm, and the OD value reached 2 ~6, then transfer to BMMY medium 200ml / 1000ml at 28~30℃, 220~270°C for 108 hours, sampling and testing every 12 hours, using GS115-pPICZαA as a contro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an amino acid sequence of beta-mannase gene and coding making method in the biological domain, which is characterized by the following: extracting Armillariella tabescens main RNA of high activity by konjaku flour evoking; using consanguinity sequence of Genebank to design degenerate primer; carrying on PCR expanding to protectorate by primer; designing gene specificity primer to carry on 3'RACE and 5'RACE; cloning total long cDNA of beta-mannase gene; constructing eucaryon expressing carrier with pichia; building-up yeast gene engineering bacterial strain.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to an acidic β-mannanase gene and the amino acid sequence and preparation method of its coded product. Background technique [0002] β-mannanase (EC3.2.1.78) is a class of endohydrolase capable of hydrolyzing β-1,4D-mannosidic bonds and belongs to hemicellulase. The hydrolyzed substrates include galactomannan, glucomannan, galactoglucomannan and mannan, and the products include a small amount of monosaccharides and oligosaccharides composed of 2 to 10 monosaccharide molecules. It has broad application prospects in pulp bleaching, feed processing, food processing, biomass conversion, etc. [0003] β-mannanase is mainly derived from microorganisms. Among the β-mannanases produced by microorganisms, they can be divided into acidic β-mannanases, neutral β-mannanases and alkaline β-mannanases according to the optimum pH range. β-mannanases for different purpose...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
26 Jul 2006
Publication
CN1807644A
IPC
C12N15/56; C12N9/24; C12N15/09
Inventors
姚冬生; 黄小葵