Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Gene recombination humanized pigment epithelium derivative factor and application therof

A humanized and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as toxic and side effects, and achieve the effect that the possibility of drug resistance is small

Inactive Publication Date: 2012-08-29
张力建 +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to solve the problem that the existing anti-angiogenic drugs will produce a certain degree of toxic and side effects when applied to the human body, the present invention provides a humanized pigment epithelium-derived factor, which is applied to the treatment of tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene recombination humanized pigment epithelium derivative factor and application therof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The invention provides a recombinant vector pEF6 / V5 / His-PEDF, which contains the gene sequence shown in SEQ ID No.1.

[0058] The present invention also provides a preparation method of the recombinant vector pEF6 / V5 / His-PEDF, comprising the following steps:

[0059] (1). Extraction of mRNA from normal tissues;

[0060] (2). cDNA product obtained by reverse transcription;

[0061] (3). Design primers as shown in SEQ ID No.2-7:

[0062] f1: 5'Atgcaggccctggtgcta3' (SEQ ID No. 2)

[0063] f2: 5'gacatgcaggccctggt3' (SEQ ID No. 3)

[0064] r1: 5'cctggggtccagaatctt3' (SEQ ID No. 4)

[0065] r2: 5'ggggcccctggggtccagaa3' (SEQ ID No.5)

[0066] r3: 5'ggggcccctggggtccagaatctt3' (SEQ ID No. 6)

[0067] r4: 5' gcccctggggtccagaat3' (SEQ ID No. 7).

[0068] (4). Amplify the full length of the PEDF gene, as shown in SEQ ID No.1;

[0069] (5). The full-length PEDF gene was introduced into the pEF6 / V5 / His plasmid vector to obtain the recombinant vector pEF6 / V5 / His-PEDF.

[0070...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene recombination humanized pigment epithelium derivative factor and application thereof, especially to a gene restructuring human pigment epithelium derivative factor and application preparing method of and provides a recombinant vector pEF6 / V5 / His-PEDF with gene sequence as SEQ ID No.1, and also provides a preparation method of pEF6 / V5 / His-PEDF. When the gene restructuring human pigment epithelium derivative factor is applied on whole body, the factor can not generate the immunogenicity and the ability of generating the chemical sprout is small, which is characterized by the following: making physiological activity as same as normal protein; having advantage of high efficiency, targeting to inhibit tumour vessel, and can play a role for restraining the generation of new vessels for almost every solid tumors.

Description

Technical field: [0001] The invention relates to a recombinant protein and its application, in particular to a gene recombination humanized pigment epithelium-derived factor and its application. Background technique: [0002] The formation of new blood vessels is a very important process in the growth and metastasis of malignant tumors, especially lung cancer. It not only provides a large amount of raw materials for lung cancer tissue growth, but also provides a channel for its distant metastasis. Under normal conditions, the vasculature in the human body is in a balanced state under the interaction of vascular growth factors and inhibitory factors; under pathological conditions, especially when malignant tumors occur, this balance develops in the direction of angiogenesis. PEDF (pigment epithelial derived factor) is the most important endogenous angiogenesis inhibitor known so far. Our previous research results have shown that PEDF is expressed to a certain extent in the cy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/12C07K14/435C12N1/21A61K38/17A61P35/00C12N9/22C12Q1/44
Inventor 张力建姜文国
Owner 张力建
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com