Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombination expression carrier for treating Aids, reformed blood building stem cell and method

A technology of hematopoietic stem cells and expression vectors, which is applied in the field of recombinant expression vectors for the treatment of AIDS, and can solve problems such as stem cell susceptibility

Inactive Publication Date: 2007-04-18
XIAMEN UNIV
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hexabenzylguanine (BG) itself does not kill stem cells, but it can make stem cells susceptible to BCNU
However, there is currently no method to efficiently introduce and express multiple siRNAs into cells at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination expression carrier for treating Aids, reformed blood building stem cell and method
  • Recombination expression carrier for treating Aids, reformed blood building stem cell and method
  • Recombination expression carrier for treating Aids, reformed blood building stem cell and method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0107] 2. A method for preparing hematopoietic stem cells after transformation, the cells carrying (1) MGMT (P140K) gene; and (2) multiple siRNAs, and / or miRNAs, and / or ribozymes targeting HIV.

[0108] A. Sequence of MGMT(P140K) (SEQ ID NO: 1)

[0109] B. Sequences of five siRNAs (SEQ ID NO: 2-6)

[0110] Preparation:

[0111] A. Crude blood stem cells were obtained from the blood of an HIV patient or a healthy donor by Ficoll-Paque density centrifugation. Use CD34 + Cell separation kit (MiltenyiMiniMACS, Miltenyi Biotec GmbH, Germany) enriched CD34 + cell.

[0112] B. One day after separation, the cells were incubated with 10% heat-inactivated fetal bovine serum, 2mM glutamine, 8μg / ml Polybrene (Sigma-Aldrich), 100ng / ml stem cell factor (SCF), 100ng / ml Flt-3L , and 50ng / ml thrombopoietin (TPO) in DMEM medium for transduction with lentiviral vector Xiada-1. The cell density was 4 x 10 5 / mL, the multiplicity of infection (MOI) was 2. Cells were moved into 37 °C 5% CO ...

Embodiment 1

[0132] Example 1. Co-transfection experiments with HIV infectious clones to screen for suitable RNAi targets

[0133] (1) The pNL4-3 plasmid is an infectious cloning plasmid of type I HIV, which will secrete complete virus particles with infectious ability after being transfected into suitable mammalian cells. p24 is the shell protein of HIV virus, and the level of secretion and expression of virus particles can be reflected by detecting the content of p24 protein in the culture supernatant;

[0134] (2) The different siRNA sequences designed were respectively constructed in the pSUPER vector (Cat.No VEC-PBS-0001 / 0002 of oligoengine company). For the specific construction process, please refer to the pSUPER experiment guide of the company ( www.oligoengine.com );

[0135] (3) The negative control in the experiment is to construct the RNAi sequence that does not match HIV and human genes into the pSUPER vector, named pSUPER(-), and the specific sequence is 5'-TGCATCGGAAAATAGAT...

Embodiment 2

[0189] Example 2. Simultaneous expression of five HIV-siRNAs:

[0190] miRNA is a kind of regulatory small RNA with a length of about 22 nucleotides. Binding of miRNA to mRNA can lead to translational repression of protein-coding genes or splicing of mRNA. Different miRNA genes are usually assembled into clusters. Therefore, we replaced five miRNA sequences (miRNA17, 18, 19a, 20, and 19b-1) with HIV-siRNA sequences in one miRNA gene cluster to simultaneously express multiple siRNAs. We synthesized full-length modified miRNA gene clusters and inserted them into lentiviral vectors. The sequences of the synthetic genes encoding the five miRNAs are as follows:

[0191] GCTGAAGATTGTGACCAGTCAGAATAATGTCGATTGTACTGAGAGATAGGTTAGTGATA

[0192] TGTGCATCTAGCCTGTCTCTCAGTACAATCAGCATTATGGTGACAGCTGCCTCGGGAAG

[0193] CCAAGTTGGGCTTTAAAGTGCAGGGCCTGCTGATGTTGAGTGCTTTTTGTTCATCTTGTGT

[0194] ATTACTACTGCCCCGTGAAGTAGATTAGCATCGGGGCAGTAGTAATATAAGATCTGGCA

[0195] TAAGAAGCTTATGTATTCATCCAATAATTCAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention involves a new treatment for AIDS recombinant expression vector, a modified cells (especially hematopoietic stem cells), and methods. The invention provides recombinant expression vector and modified cells (especially hematopoietic stem cells), its expression: (1) MGMT (P140K) gene; and (2) various (especially targeting HIV) siRNA and / or miRNAs and / or ribozymes, and / or anti - oligonucleotides. The invention also provides treatment of HIV infection, including (1) Preparation of the cell of this invention, then transplant to their patients with HIV infection; and (2) BG / BCNU appropriate treatment.

Description

technical field [0001] The invention relates to the field of gene therapy, in particular to recombinant expression vectors, modified cells (especially hematopoietic stem cells) and methods for treating AIDS. Background technique [0002] Currently, the treatment of HIV infection is mainly based on high-intensity antiretroviral therapy, which uses a combination of inhibitors against viral reverse transcriptase and protease. Unfortunately, HIV has a high mutation rate and complex pathogenesis, and thus is able to evade treatment. Because HIV-1 can integrate into the genome of cells, the genome of the virus can exist in cells for a long time. After drug treatment, HIV-1 can still reactivate and expand in CD4+ cells carrying HIV-1 genome. Therefore, there is a need to develop new therapeutic means to deal with HIV infection. [0003] For a long time, introducing target genes into human hematopoietic stem cells (HSCs) to treat human diseases has been th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/63C12N15/85C12N15/86C12N15/867C12N5/10A61P37/00A61K35/12
Inventor 夏宁邵史长平林圣彩
Owner XIAMEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More