Recombination expression carrier for treating Aids, reformed blood building stem cell and method
A technology of hematopoietic stem cells and expression vectors, which is applied in the field of recombinant expression vectors for the treatment of AIDS, and can solve problems such as stem cell susceptibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0107] 2. A method for preparing hematopoietic stem cells after transformation, the cells carrying (1) MGMT (P140K) gene; and (2) multiple siRNAs, and / or miRNAs, and / or ribozymes targeting HIV.
[0108] A. Sequence of MGMT(P140K) (SEQ ID NO: 1)
[0109] B. Sequences of five siRNAs (SEQ ID NO: 2-6)
[0110] Preparation:
[0111] A. Crude blood stem cells were obtained from the blood of an HIV patient or a healthy donor by Ficoll-Paque density centrifugation. Use CD34 + Cell separation kit (MiltenyiMiniMACS, Miltenyi Biotec GmbH, Germany) enriched CD34 + cell.
[0112] B. One day after separation, the cells were incubated with 10% heat-inactivated fetal bovine serum, 2mM glutamine, 8μg / ml Polybrene (Sigma-Aldrich), 100ng / ml stem cell factor (SCF), 100ng / ml Flt-3L , and 50ng / ml thrombopoietin (TPO) in DMEM medium for transduction with lentiviral vector Xiada-1. The cell density was 4 x 10 5 / mL, the multiplicity of infection (MOI) was 2. Cells were moved into 37 °C 5% CO ...
Embodiment 1
[0132] Example 1. Co-transfection experiments with HIV infectious clones to screen for suitable RNAi targets
[0133] (1) The pNL4-3 plasmid is an infectious cloning plasmid of type I HIV, which will secrete complete virus particles with infectious ability after being transfected into suitable mammalian cells. p24 is the shell protein of HIV virus, and the level of secretion and expression of virus particles can be reflected by detecting the content of p24 protein in the culture supernatant;
[0134] (2) The different siRNA sequences designed were respectively constructed in the pSUPER vector (Cat.No VEC-PBS-0001 / 0002 of oligoengine company). For the specific construction process, please refer to the pSUPER experiment guide of the company ( www.oligoengine.com );
[0135] (3) The negative control in the experiment is to construct the RNAi sequence that does not match HIV and human genes into the pSUPER vector, named pSUPER(-), and the specific sequence is 5'-TGCATCGGAAAATAGAT...
Embodiment 2
[0189] Example 2. Simultaneous expression of five HIV-siRNAs:
[0190] miRNA is a kind of regulatory small RNA with a length of about 22 nucleotides. Binding of miRNA to mRNA can lead to translational repression of protein-coding genes or splicing of mRNA. Different miRNA genes are usually assembled into clusters. Therefore, we replaced five miRNA sequences (miRNA17, 18, 19a, 20, and 19b-1) with HIV-siRNA sequences in one miRNA gene cluster to simultaneously express multiple siRNAs. We synthesized full-length modified miRNA gene clusters and inserted them into lentiviral vectors. The sequences of the synthetic genes encoding the five miRNAs are as follows:
[0191] GCTGAAGATTGTGACCAGTCAGAATAATGTCGATTGTACTGAGAGATAGGTTAGTGATA
[0192] TGTGCATCTAGCCTGTCTCTCAGTACAATCAGCATTATGGTGACAGCTGCCTCGGGAAG
[0193] CCAAGTTGGGCTTTAAAGTGCAGGGCCTGCTGATGTTGAGTGCTTTTTGTTCATCTTGTGT
[0194] ATTACTACTGCCCCGTGAAGTAGATTAGCATCGGGGCAGTAGTAATATAAGATCTGGCA
[0195] TAAGAAGCTTATGTATTCATCCAATAATTCAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 