Cloning of Japanese blood fluke vaccine antigen gene and its expression and application
A schistosomiasis and vaccine technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of different diseases, repeated infection of patients and sick animals, and no public reports of new schistosomiasis vaccines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Acquisition of Schistosoma japonicum antigen SjE16 and antigen SjP50 genes.
[0042] 1. Design and synthesis of primers
[0043] According to the sequence of Sj50 gene and Sj16 gene, primers were analyzed and designed by Primerexpress software, and two pairs of primers were synthesized by Shanghai Shenyou Bioengineering Company.
[0044] Sj50-F is 5'CCGGAATTCATGTCGGAGACGCCAAAGC3' (SEQ ID NO: 5), and the EcoR I restriction site GAATTC is introduced;
[0045] Sj50-R is 5'CCGCTCGAGCAGAATTAAGCTCTCACAGGGCA3' (SEQ ID NO: 6); the Xho I restriction site CTCGAG is introduced;
[0046] Primer Sj16-F is 5'CCGGAATTCCTTCATCTCAGAATAATGTCGGA3' (SEQ ID NO: 7), which introduces EcoR I restriction site GAATTC;
[0047] Sj16-R is 5'CCGCTCGAGCATACGTTTGACGTACATAAGCT3' (SEQ ID NO: 8), which introduces the Xho I restriction site CTCGAG.
[0048] The stock concentration of primers is 50mM, and the working concentration is 10mM.
[0049] 2. PCR amplification of Sj50 gene and Sj16 gene
[0...
Embodiment 2
[0054] Cloning and expression of Schistosoma japonicum antigen SjE16 and antigen SjP50 genes.
[0055] 1. Construction of expression vector
[0056] The recovered and purified Sj50 gene, Sj16 gene and plasmid pGEX4T-1 were digested with restriction endonucleases EcoR I and Xho I, respectively. 10 μl template plus EcoR I 1 μl, Xho I 1 μl, EcoR I buffer 1.5 μl, BSA 0.5 μl and deionized water 1 μl, a total of 15 μl was placed in a 1.5ml Eppendorf tube in a 37°C water bath overnight.
[0057] The digested Sj50 gene, Sj16 gene and plasmid pGEX4T-1 were recovered and purified with QIAquick PCR Purification kit. Purified target gene fragments and carrier digested fragments, measured OD value, calculated the concentration of fragments and carrier fragments, and connected target fragments and carrier fragments at a molar ratio of 3:1. The ligation system contains 1 μl of T4 DNA ligase, 1 μl of 10× ligation buffer, deionized water, pGEX4T-1 (80ng), Sj50 gene (60ng) or Sj16 gene (20ng)...
Embodiment 3
[0071] RT-PCR identification of the transcriptional expression of SjE16 and SjP50 in each developmental stage of Schistosoma japonicum.
[0072] 1. Sample Preparation
[0073] The eggs, cercariae, males, and females of Schistosoma japonicum were prepared to extract their RNA.
[0074] 2. Total RNA extraction kit
[0075] The RNA extraction reagent uses TRIzol reagent (GIBCO / BRL), which is produced based on the one-step extraction method with acidic phenol. The utensils and water used for RNA extraction must be RNase-free to ensure an RNase-free environment in the experiment.
[0076] 3. RNA extraction steps
[0077] Dry-bake the pestle, homogenizer and other utensils at 200°C for 4 hours to remove RNase and cool down; add liquid nitrogen to pre-cool, take the tissue out of the liquid nitrogen quickly, and grind it into powder; use a spatula to put the tissue into the pre- Add TRIzol reagent to the homogenizer and homogenize for several minutes; transfer the homogenized liq...
PUM
| Property | Measurement | Unit |
|---|---|---|
| electrical resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 