Transgenic models of alzheimer's disease and uses therefor in the treatment of a variety of neurodegenerative diseases

A technology of transgenic animals and residues, applied in gene therapy, nervous system diseases, disease diagnosis, etc., can solve the problem of unclear exact mechanism of amyloid toxicity, and achieve the goal of preventing the loss of hippocampal synapses and the atrophy of the dentate gyrus Effect

Inactive Publication Date: 2007-05-16
THE BUCK INST FOR RES ON AGING
View PDF18 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The precise mechanism of amyloid toxicity is unknown, but evidence has accumulated that synapses are early vulnerable sites of Aβ damage (see, e.g., Selkoe, D.J., Science 298:789-91 (2002))

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic models of alzheimer's disease and uses therefor in the treatment of a variety of neurodegenerative diseases
  • Transgenic models of alzheimer's disease and uses therefor in the treatment of a variety of neurodegenerative diseases
  • Transgenic models of alzheimer's disease and uses therefor in the treatment of a variety of neurodegenerative diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

Generation of PDAPP(D664A) Mutation

[0109] Point mutations from G to C were introduced into the PDGF β chain promoter-driven hAPP minigene with Swedish and Indiana mutations (see Hsia et al, supra), which mutated Asp664 (APP695 numbering) into is Ala (PDAPP (D664A)). The mutation was confirmed by sequencing and allele-specific amplification.

Embodiment 2

Generation of transgenic mice

[0110] Microinjection of the PDAPP(D664A) transgene was performed as previously described, transgenic founders were identified by PCR, and the PDAPP(D664) B21 strain was selected for this study (see Li, Y., Carlson, E., Murakami, K., Copin, J.C., Luche, R., Chen, S.F., Epstein, CJ. and Chan, P.H., J Neurosci Methods 89, 49-55 (1999)), basically as follows.

[0111] A solution of 2 ng / μl linearized, carrier-sequence-free purified human PDAPP (D664A) transgenic DNA was microinjected into male pronuclei of 1-day-old B6D2F1 / J eggs and transferred into pseudopregnant CD1 surrogates 24 hours later In the womb. Founder identification was performed by PCR using primers specific for the hAPP transgene:

GGTGAGTTTGTAAGTGATGCC (SEQ ID NO: 1), and

TCTTCTTCTTCCACCTCAGC (SEQ ID NO: 2),

and primers specific for the mouse PKR gene:

CAGGCCACTGGGAGGAAAAATG (SEQ ID NO: 3), and

ACCTTCTGTCATGTGGAGGTCC (SEQ ID NO: 4).

[0112] Other transgenic lines prepare...

Embodiment 3

Detection of soluble Aβ

[0114] Aβ levels in the brain were determined from CHAPS soluble lysates using the 26D6 anti-APP monoclonal antibody recognizing residues 1–12 of the Aβ peptide by immunoprecipitation followed by western blot. The immunoprecipitates were fractionated on N-bicine-urea SDS-PAGE gels to separate the A[beta]40 and A[beta]42 species (see Weggen, et al, Nature 414:212-6 (2001)). APP was obtained from immunoblotting of CHAPS brain lysates using CT15, a polyclonal antibody that recognizes the C-terminus of APP. All animals were age-matched between 3-4 months of age prior to deposition of aggregated Aβ peptide.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

In accordance with the present invention, it is demonstrated that selected mutations such as an Asp -> Ala (D664A) mutation in APP (which prevents cleavage at the caspase cleavage site) prevent both hippocampal synaptic loss and dentate gyral atrophy, even though such mutations do not interfere with the production of Ass or the formation of amyloid plaques in a transgenic model of Alzheimer's disease. Accordingly, in view of this finding, methods have been developed for the identification of agents which block cleavage at Asp664 of APP, including transgenic animals which are useful for such purpose, as well as methods for the use thereof for the treatment of neurodegenerative diseases.

Description

technical field [0001] The present invention relates to non-human transgenic models of Alzheimer's disease and uses thereof, including methods of identifying compounds useful in the treatment of Alzheimer's disease, methods of using such compounds for therapy, and the like. Background technique [0002] Alzheimer's disease (AD), the most common form of dementia, is characterized by senile plaques, neurofibrillary tangles and loss of synapses and neurons in the brain. The major protein component of senile plaques is β-amyloid peptide (Aβ), which is produced by proteolytic cleavage of its precursor β-amyloid precursor protein (APP). The amyloid hypothesis states that Aβ initiates a cascade of events leading to AD. The precise mechanism of amyloid toxicity is unknown, but evidence has accumulated that synapses are early vulnerable sites of Aβ damage (see, eg, Selkoe, D.J., Science 298:789-91 (2002)). Consistent with this notion, some APP transgenic mice with high levels of Aβ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/70A01K67/00G01N33/00A01K67/027A61K38/54A61K48/00C12N15/85C12Q1/37G01N33/50G01N33/68
CPCG01N2500/02G01N33/5088A01K2227/105G01N2800/2821A01K2217/00C12Q1/37G01N33/6896G01N2333/96466A01K2227/108G01N2800/2814C12N15/8509A01K2267/0312G01N2333/4709A61K48/00A01K2227/107A01K67/0275A01K2207/15A61P25/28
InventorD·E·布雷德森V·加尔万
OwnerTHE BUCK INST FOR RES ON AGING