Check patentability & draft patents in minutes with Patsnap Eureka AI!

Brain-protective agent

a brain-protective agent and agent technology, applied in the direction of drug compositions, peptide/protein ingredients, metabolic disorders, etc., can solve the problem of no effective therapeutic modalities established

Inactive Publication Date: 2004-04-01
ANGES MG INC
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

0005] The inventors of this invention predicted that activation of the production of cytokines and cell adhesion factors which are under regulation by NF-.kappa.B is one of the causes for triggering brain disorders associated with encephalopathy (for example, the cerebral vasospasm following a subarachnoidal hemorrhage and apoptosis of the nerve cells following a cerebrovascular accident or serious head injury) and did intensive investigations. As a result, they discovered that for protection of the brain against brain disorders associated with encephalopathy, it is especially effective to administer an NF-.kappa.B decoy, that is to say a compound specifically competing with the nucleic acids to which NF-.kappa.B binds, and ultimately developed this instant invention.

Problems solved by technology

However, as to brain disorders such as the cerebral vasospasm following subarachnoid hemorrhage, the mechanisms of onset remain to be elucidated and no effective therapeutic modalities have been established yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] Construction of the Animal Model

[0023] As experimental animals, male New Zealand White rabbits weighing 2.about.2.5 kg were used. Each experimental animal was anesthetized with pentobarbital, 20 mg / kg i.v. The auricular artery was cannulated and the arterial blood was harvested. The head was then immobilized in a stereotaxic frame and the atlanto-occipital membrane was exposed by inducing contraction of the nuchal muscle. After 1 ml of cerebrospinal fluid was aspirated off, 1 mg / kg of autologous blood was carefully injected into the cistern (subarachnoid space) over not less than 3 minutes using a 27 G needle. Then, the animal's head was tilted down and kept in that position for 30 minutes so as to flood the basilar artery with the animal's autologous blood for the construction of a subarachnoid hemorrhage model.

[0024] Administration of the Decoy

[0025] A rabbit NF-.kappa.B binding recognition sequence (20 mer; TGGAGGGGCTTTCCCCATAG) (NF-.kappa.B decoy group) and a scrambled NF...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
vesicle sizeaaaaaaaaaa
vesicle sizeaaaaaaaaaa
adhesionaaaaaaaaaa
Login to View More

Abstract

A brain-protective agent containing an NF-kappaB decoy. In brain diseases, the brain can be particularly effectively protected against brain disorders (for example, cerebral vasospasm following a subrachnoidal hemorrhage and apoptosis of the nerve cells following a cerebrovasucular accident or serious head injury) caused by the undesired activation of cytokines or cell adhesion factors which are regulated by NF-kappaB by administering the brain-protective agent containing an NF-kappaB decoy, i.e., a compound antadonistic specifically to a nucleic acid to which NF-kappaB binds.

Description

[0001] This invention relates to a brain-protective agent comprising an NF-.kappa.B decoy, particularly a brain-protective agent for the brain disorder associated with encephalopathy. More particularly, the invention relates to a brain-protective agent comprising an NF-.kappa.B decoy for brain disorders arising from encephalopathy and to a method of protecting the brain which comprises using a brain-protective agent comprising said decoy.[0002] The transcription factor NF-.kappa.B is considered to be related to various diseases such as ischemic, inflammatory and autoimmune diseases, and it is expected that administration of its decoy will be effective in the therapy and prophylaxis of such diseases (WO 96 / 35430). The transcription factor NF-.kappa.B is a heterodimeric complex of p65 and p50 proteins. This factor usually exists in the form of a complex with the inhibitor protein I.kappa.B in the cytoplasm and, as such, is prevented from migrating to the nucleus. However, when exposed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K38/00C12N15/113
CPCA61K38/00C12N2310/13C12N15/113A61P43/00A61P9/00
Inventor ONO, SHIGEKIDATE, ISAO
Owner ANGES MG INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More