Brain-protective agent
a brain-protective agent and agent technology, applied in the direction of drug compositions, peptide/protein ingredients, metabolic disorders, etc., can solve the problem of no effective therapeutic modalities established
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
Embodiment Construction
[0022] Construction of the Animal Model
[0023] As experimental animals, male New Zealand White rabbits weighing 2.about.2.5 kg were used. Each experimental animal was anesthetized with pentobarbital, 20 mg / kg i.v. The auricular artery was cannulated and the arterial blood was harvested. The head was then immobilized in a stereotaxic frame and the atlanto-occipital membrane was exposed by inducing contraction of the nuchal muscle. After 1 ml of cerebrospinal fluid was aspirated off, 1 mg / kg of autologous blood was carefully injected into the cistern (subarachnoid space) over not less than 3 minutes using a 27 G needle. Then, the animal's head was tilted down and kept in that position for 30 minutes so as to flood the basilar artery with the animal's autologous blood for the construction of a subarachnoid hemorrhage model.
[0024] Administration of the Decoy
[0025] A rabbit NF-.kappa.B binding recognition sequence (20 mer; TGGAGGGGCTTTCCCCATAG) (NF-.kappa.B decoy group) and a scrambled NF...
PUM
| Property | Measurement | Unit |
|---|---|---|
| vesicle size | aaaaa | aaaaa |
| vesicle size | aaaaa | aaaaa |
| adhesion | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 