Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for treating retinal degeneration with purinergic receptor agonists

Inactive Publication Date: 2005-01-13
PETERSON WARD M
View PDF21 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides a method of preventing or treating retinal degeneration, wherein the retinal degeneration arises from pathophysiological or physical conditions. The method comprises administering to a patient a pharmaceutical composition comprising a P2Y receptor ligand, in an effective amount to activate cell surface P2Y receptors of retinal glial and neuronal cells to mount a neuroprotective response. Methods of administering include intravitreal bolus and sustained administrations, transscleral delivery, topical, oral and systemic administrations, and intraoperative administration.
The pharmaceutical compositions useful in this invention comprise P2Y receptor agonists. P2Y agonists activate Ca2+ signaling, mitogen-activated protein kinase signaling, and glial fibrillary acidic protein expression in glial cells of the retina. P2Y agonists include uridine 5′-di′- and triphosphate (UDP, UTP) and their analog

Problems solved by technology

Currently subconjunctival injection of ATP is not used for treating retinal dystrophies.
Currently, these treatments have not been developed for use in the clinic.
Although features of P2Y receptor signaling in many cell types are well known, the physiological roles of P2Y receptors in the nervous system are not well-characterized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for treating retinal degeneration with purinergic receptor agonists
  • Method for treating retinal degeneration with purinergic receptor agonists
  • Method for treating retinal degeneration with purinergic receptor agonists

Examples

Experimental program
Comparison scheme
Effect test

example 1

Localization of P2Y Receptor Gene Expression in Rabbit and Primate Retina

Tissues. Albino rabbit and monkey retina were prepared following enucleation of the eye, fixation, and cryopreservation. Tissue were cryosectioned into cross-sections across the retina, retinal pigment epithelium, and choroid into 5 μm thick sections and mounted onto glass slides for in situ hybridization with sense and anti-sense oligonucleotide probes specifically designed against regions of the P2Y2 mRNA. Tissues were also counter stained with hemotoxylin and eosin (H&E) to evaluate the quality and orientation of study tissues. Examination of H&E slides indicated that all tissues were suitable for ISH.

Riboprobe Synthesis. A PCR product containing nucleotides 253-651 from a human P2Y2—R cDNA was obtained from a sponsor. P2Y2—R nucleotides 272-627 were reamplified with P2Y2 primers (forward primer sequence: 5′ AGGAGATGTGTTGGGCAGCAGTGAGGAC 3′, SEQ ID NO:1; reverse primer sequence: reverse 5′ ACCAGGGTTTTCTGG...

example 2

Protection of Photoreceptors from the Damaging Effect of Constant Light

Animal models. Photoreceptors of albino Sprague-Dawley rats are susceptible to damage as a result of exposure approximately 4 days of constant bright light. The light-induced photoreceptor degeneration in Sprague-Dawley rats is a widely used animal model for retinal degeneration in humans following exposure to toxic levels of bright light, or in diseased conditions (LaVail, et al., Proc Natl Acad. Sci., 89:11249-11253, 1992). This model is used to test the ability of P2Y2 receptor to protect photoreceptors from degeneration caused by exposure to constant bright light.

Experimental design. Sprague-Dawley rats are brought in at ˜10 weeks of age and housed under 12 hour cyclic light / dark illumination with an in-cage illuminance of ˜20 ft-cd. Two days prior to exposure to bright light, animals are injected with P2Y receptor agonists, such as ADP, UDP, UTP or dCP4U, and returned to normal cyclic lighting conditions...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method of preventing or treating retinal degeneration arising from pathophysiological or physical conditions. The method comprises administering to a patient a pharmaceutical composition comprising a purinergic P2Y receptor ligand, in an amount effective to elevate its extracellular concentration to activate retinal glial and neuronal cell surface P2Y receptors and mount a neuroprotective response. Methods of administering including intravitreal bolus and sustained administrations, transscleral delivery, topical, and systemic administrations. The pharmaceutical composition useful in this invention comprises a P2Y purinergic receptor agonist, which include uridine 5′-di- and triphosphate (UDP, UTP) and their analogs, adenosine 5′-diphosphate (ADP) and its analogs, cytidine 5′-di- and triphosphate (CDP, CTP) and their analogs, and dinucleoside polyphosphate compounds.

Description

TECHNICAL FIELD The present invention relates to a method of protecting or delaying retinal neurons from cell death by administering purinergic receptor agonists such as uridine 5′-di- and triphosphates, cytidine 5′-di- and triphosphates, dinucleoside polyphosphates, and their analogs thereof. BACKGROUND OF THE INVENTION Degeneration of retinal neurons is a debilitating condition and a major cause of irriversible blindness worldwide (National Eye Institute, “Vision Research: A National Plan, 1994-1998”). Retinal degeneration is often an endpoint of a variety of ocular and systemic diseases and environmental conditions. Degenerative retinopathies generally affect two neuronal cell populations in the retina: the photoreceptors and ganglion cells. Degeneration of photoreceptors and ganglion cells can arise from neurodegenerative diseases (macular degeneration, glaucoma, retinitis pigmentosa), optic nerve degeneration and optic neuritis, chronic metabolic diseases (proliferative diabe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K9/02A61K9/06A61K9/08A61K9/10A61K9/12A61K9/127A61K9/14A61K9/70A61K9/72A61K31/7068A61K31/7072A61K31/7076A61K31/7084A61K45/00A61P25/02A61P27/02A61P27/06A61P29/00A61P43/00C07H19/10C07H19/20C07H19/207
CPCC07H19/10C07H19/207C07H19/20A61P25/02A61P27/02A61P27/06A61P29/00A61P43/00A61K31/706
Inventor PETERSON, WARD M.
Owner PETERSON WARD M