Method for treating retinal degeneration with purinergic receptor agonists
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Localization of P2Y Receptor Gene Expression in Rabbit and Primate Retina
Tissues. Albino rabbit and monkey retina were prepared following enucleation of the eye, fixation, and cryopreservation. Tissue were cryosectioned into cross-sections across the retina, retinal pigment epithelium, and choroid into 5 μm thick sections and mounted onto glass slides for in situ hybridization with sense and anti-sense oligonucleotide probes specifically designed against regions of the P2Y2 mRNA. Tissues were also counter stained with hemotoxylin and eosin (H&E) to evaluate the quality and orientation of study tissues. Examination of H&E slides indicated that all tissues were suitable for ISH.
Riboprobe Synthesis. A PCR product containing nucleotides 253-651 from a human P2Y2—R cDNA was obtained from a sponsor. P2Y2—R nucleotides 272-627 were reamplified with P2Y2 primers (forward primer sequence: 5′ AGGAGATGTGTTGGGCAGCAGTGAGGAC 3′, SEQ ID NO:1; reverse primer sequence: reverse 5′ ACCAGGGTTTTCTGG...
example 2
Protection of Photoreceptors from the Damaging Effect of Constant Light
Animal models. Photoreceptors of albino Sprague-Dawley rats are susceptible to damage as a result of exposure approximately 4 days of constant bright light. The light-induced photoreceptor degeneration in Sprague-Dawley rats is a widely used animal model for retinal degeneration in humans following exposure to toxic levels of bright light, or in diseased conditions (LaVail, et al., Proc Natl Acad. Sci., 89:11249-11253, 1992). This model is used to test the ability of P2Y2 receptor to protect photoreceptors from degeneration caused by exposure to constant bright light.
Experimental design. Sprague-Dawley rats are brought in at ˜10 weeks of age and housed under 12 hour cyclic light / dark illumination with an in-cage illuminance of ˜20 ft-cd. Two days prior to exposure to bright light, animals are injected with P2Y receptor agonists, such as ADP, UDP, UTP or dCP4U, and returned to normal cyclic lighting conditions...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


