Compositions and methods for combined therapy of disease

a combination therapy and disease technology, applied in the field of diseases, can solve the problems of pathogenic condition, increase in red cell destruction, anemia, downregulation of pedf expression, etc., and achieve the effect of reducing the expression of at least one first gene, increasing expression, and reducing the expression of the first gene in the target cell

Inactive Publication Date: 2011-12-08
THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Uncontrolled or inappropriate angiogenesis in mature organisms can cause a pathogenic condition.
Hypoxic conditions in the eye lead to downregulation of PEDF expression, and patients with AMD often lack PEDF in their vitreous.
Altering the amount of gene products produced from pro- and anti-apoptotic Bcl-2 gene family members can lead to an increase in red cell destruction and anemia.
However, while RNAi can efficiently reduce the amount of cellular factor gene expression in a given cell, it does not increase the amount of anti-angiogenic factors within a cell.
However, increasing the level of anti-angiogenic factors in a given cell does not remove the pro-angiogenic signals still present within the cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for combined therapy of disease
  • Compositions and methods for combined therapy of disease
  • Compositions and methods for combined therapy of disease

Examples

Experimental program
Comparison scheme
Effect test

example 1

Expression of PEDF and siRNA Targeted to VEGF in Human Cells

[0169]Plasmids expressing human PEDF and either hVEGF#5 or hVEGF#2 siRNA (which target human VEGF mRNA) or negative control siRNA were constructed as follows. Complementary oligonucleotides for expressing hVEGF#5 or hVEGF#2 siRNA were synthesized, annealed, and ligated into pSilencer 2.0-U6 siRNA Expression Vector (Ambion #7209). An oligonucleotide sequence for expressing a negative control hairpin siRNA was also synthesized, annealed and ligated into the pSilencer vector. The negative control siRNA consisted of a random target sequence. These oligonucleotides formed a hairpin structure when expressed. (See FIG. 3 for a schematic of the hVEGF#5 target sequence, the annealed DNA insert encoding hVEGF#5 hairpin siRNA, and the hVEGF#5 hairpin siRNA.).

[0170]The complementary oligonucleotides used to form the double-stranded insert encoding the hVEGF#5 siRNA hairpin were:

hVEGF#5-a(SEQ ID NO. 1728)GATCCACCTCACCAAGGCCAGCACTTCAAGAG...

example 2

Expression of Angiostatin and siRNA Targeted to HIF-1 alpha in Human Cells

[0181]Two complementary oligonucleotides were synthesized, annealed, and ligated into pSilencer 2.0-U6 siRNA Expression Vector (Ambion #7209) as in Example 1 above, to express either a hairpin siRNA hHIF1α#11 or a negative control siRNA targeted to EGFP. The complementary oligonucleotides used to form the double-stranded DNA insert encoding the HIF1-alpha siRNA hairpin were:

hHIF1-alpha#11-a(SEQ ID NO. 1732)GATCCAGTCGGACAGCCTCACCAATTCAAGAGATTGGTGAGGCTGTCCGACTTTTTTTGGAAAhHIF1-alpha#11-b(SEQ ID NO. 1733)AGCTTTTCCAAAAAAAGTCGGACAGCCTCACCAATCTCTTGAATTGGTGAGGCTGTCCGACTG

[0182]The DNA fragments encoding the siRNA hairpin structures were excised from the pSilencer vector along with the pU6 promoter using PvuII, and inserted into the pCMS-EGFP vector (BD #6101-1) in place of the EGFP / PvuII fragment. The resulting plasmids were named pCMS-pU6-(siRNA). A human angiostatin cDNA fragment (the N-terminal fragment of human pla...

example 3

Construction of Adeno-Associated Viral Vector Expressing RNAi Compounds

[0188]The nucleotide sequences encoding the anti-angiogenic compound (PEDF or angiostatin) and the siRNA will be excised from plasmids pCMS-PEDF-pU6-HVEGF#5; pCMS-PEDF-pU6-hVEGF#2 and pCMS-Angst-pU6-hHIF1-alpha#11, and inserted in between the inverted terminal repeats of a commercially available adeno-associated viral (AAV) plasmid. Recombinant AAV vector will be prepared by using the three-plasmid cotransfection system as described, for example, in Matsushita, T., 1998, Gene Ther. 5, 938-945, the entire disclosure of which is herein incorporated by reference. Briefly, the AAV vector will be cotransfected with two helper plasmids (Avigen, Alameda, Calif.) into HEK 293 cells by the CaPi precipitate method. One helper plasmid, pLadeno5, will contain the adenoviral VA, E2A, and E4 regions that mediate AAV vector replication. The other helper plasmid, pHLP19, will have the AAV rep and cap genes. Cell lysates will be ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A desired physiological state can be induced by altering the amount of gene products in target cells of a subject. The target cells are treated with at least one compound designed to reduce expression of at least one first gene by RNAi, and with at least one compound designed to increase expression from at least one second gene. The reduced expression of the first gene and the increased expression from the second gene in the target cells induces the desired physiological state in the subject. By altering target cell gene expression in this way, conditions such as angiogenesis or tumor growth and metastasis can be inhibited.

Description

CROSS REFERENCE TO RELATED INVENTIONS[0001]This application claims the benefit of co-pending U.S. Provisional Application Ser. No. 60 / 532,099, filed Dec. 23, 2003, the entire disclosure of which is herein incorporated by reference.FIELD OF THE INVENTION[0002]This invention relates to compositions and methods for treating diseases, in particular angiogenic diseases, by reducing expression of at least one gene and increasing the amount of gene product from another gene in a cell to achieve a desired physiological effect.BACKGROUND[0003]In mature human tissues, the ability to initiate angiogenesis (also called “neovascularization”) is typically held under strict control through a balance of pro- and anti-angiogenic factors in the cells. Angiogenesis therefore occurs only under certain controlled circumstances in the adult, such as in wound healing or during certain stages of the menstrual cycle. Uncontrolled or inappropriate angiogenesis in mature organisms can cause a pathogenic condi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K38/48C12N15/63A61P29/00A61P35/00A61P27/02A61P17/06A61K31/713A61K38/17A61K45/06A61K48/00C12N15/11C12N15/113C12N15/864
CPCA61K45/06A61K48/005C12N15/111C12N15/113C12N15/1136C12N2750/14143C12N2310/111C12N2310/14C12N2310/53C12N2320/31C12N15/86A61P13/08A61P17/06A61P19/02A61P27/02A61P29/00A61P35/00A61P35/02A61P43/00A61P9/00
InventorREICH, SAMUEL J.TOLENTINO, MICHAEL J.
OwnerTHE TRUSTEES OF THE UNIV OF PENNSYLVANIA