Long-acting coagulation factors and methods of producing same
a technology of coagulation factors and long-acting coagulation, which is applied in the field of long-acting coagulation factors and methods of producing same, can solve the problems of premature death, debilitating permanent damage to joints and other organs, and patients with hemophilia that do not produce sufficient amounts of factor viii or factor ix proteins, so as to prevent hemophilia, prevent blood clotting or coagulation disorder, and prevent hemophilia
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Generation and Utilization of Coagulation Factor IX
[0327]Cloning and Expression of Recombinant FIX Molecule:
[0328]Factor IX clones were constructed in our eukaryotic expression vector pCI-neo (Promega, catalog no. E1841). ORF Clone of Homo sapiens coagulation factor IX was ordered from “OriGene” (RC219065). Primers were ordered from Sigma-Genosys.
[0329]Construction of 301-1-pCI-neo-p200-11 (Factor IX-ctp x2):
(SEQ ID NO: 36)Primer 101: 5′ GTTTAGTGAACCGTCAGAAT 3′(SEQ ID NO: 37)Primer 103R: 5′ TTGAGGAAGATGTTCGTGTA 3′(contains the SspI site of factor IX)
[0330]A PCR reaction was conducted with primer 101 and primer 103R and plasmid DNA, cDNA clone of Factor IX (OriGene″ RC219065) as a template; as a result of the PCR amplification, a ˜1085 bp (per 10) product was formed and purified from the gel (the fragment containing the amino terminus of Factor IX sequence).
(SEQ ID NO: 38)Primer 98: 5′ ATTACAGTTGTCGCAGGTGA 3′(SEQ ID NO: 39)Primer 99R: 5′ GCTGGAGCTAGTGAGCTTTGTTTTTTCCTT 3′(SEQ ID NO: 4...
example 2
Comparative Assessment of Purified FIX-CTP3 vs. FIX-CTP4 and FIX-CTP5
[0394]2.1 Study Objective
[0395]A comparative assessment of the pharmacokinetic parameters of FIX-CTP4 and FIX-CTP5 versus FIX-CTP3 following a partial purification process.
[0396]2.2 Production of FIX-CTP4 and FIX-CTP5 Harvests
[0397]FIX cDNA (OriGene RC219065) fused at the C-terminal to four or five tandem CTP sequences was expressed in Dg44 cells using Excellgene expression system in the presence of 10 ng / L of vitamin K3 (Sigma, Mennadion). The harvests were collected (300 ml), filtered and frozen.
[0398]2.3 Production of FIX-CTP3 Harvest
[0399]FIX-CTP3 was expressed in-house in CHO cells using pCI-DHFR vector, clone 196, BR-9 in the presence of 25 ng / L of vitamin K3 (Sigma). The harvests were collected and filtered.
[0400]All FIX-CTP samples (3, 4 and 5 CTP) were purified only by Jacalin column because of a lack of material.
[0401]2.4 Determination of FIX Antigen Level
[0402]FIX antigen level was determined using Huma...
example 3
FIX-CTP3 Treatment of FIX− / −Hemophilic Mouse Model
[0417]As described above, a study testing FIX-CTP, FIX-CTP2 and FIX-CTP3 harvest PK profile and coagulation activity vs. rhFIX was conducted. FIX-CTP3 exhibited an improved PK profile while maintaining its coagulation activity vs. FIX-CTP1 and FIX-CTP2 harvests or rhFIX. To further evaluate this result, FIX-CTP3 γ-Carboxyglutamate protein was purified. FIX-CTP3 exhibits a 3-fold increase in half-life and 4.5-fold higher AUC compared to rhFIX in normal rats following a single IV administration. FIX-CTP3 demonstrated a reduced in vitro chromogenic and clotting activity, most likely due to insufficient cleavage of N-terminal pro-peptide and in appropriate post-transcriptional modifications (PTMs), such as appropriate gamma carboxylation.
[0418]In the current study, the pharmacokinetic and pharmacodynamic properties of human recombinant FIX fused to three tandem CTPs were tested in FIX-deficient mice.
[0419]Study Purpose:
[0420]To determine...
PUM
Property | Measurement | Unit |
---|---|---|
pharmaceutical composition | aaaaa | aaaaa |
area | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com