Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof

A technology of genetically engineered vaccines and spleen-kidney necrosis virus, applied in genetic engineering, botany equipment and methods, biochemical equipment and methods, etc., can solve problems such as harm, unfavorable immunopathological reactions, unexpected biological activity of antigens, etc., and achieve production Low cost, simple preparation process, good growth effect

Inactive Publication Date: 2009-12-09
SUN YAT SEN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In theory, the introduction of exogenous DNA into sensitive cells in the body may cause tumor cell formation by inserting and activating oncogenes, inserting and activating host cell proto-oncogenes or inserting and inactivating suppressor genes. Although this probability is very low; (2) exogenous Chronic expression of antigens may lead to adverse immunopathological responses; (3) use of genes encoding cytokines or co-stimulatory molecules may have additional hazards; (4) possible formation of antibodies against injected DNA and adverse autoimmune disorders; (5) The expressed antigen may produce unexpected biological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof
  • Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof
  • Fishes infectious spleen and kidney necrosis virus gene engineering vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0066] Vaccine Composition:

[0067] This vaccine consists of a protein solution containing two gene recombinant protein protein-24 and protein-50 antigens and an adjuvant (MONTANIDE ISA 763A, seppic, france),

[0068] The preparation of the gene recombinant protein protein-24 and protein-50:

[0069] Two open reading frames (Open Reading Frame, ORF) ORF24 and ORF50 encoding ISKNV envelope protein were screened in the ISKNV genome. ORF24 encodes a protein with a length of 313AA and a transmembrane region at position 148-170. The length of ORF50 encoded protein is 143AA. There is a transmembrane region at the 116-138AA position.

[0070] The ORF base sequence used is:

[0071] ORF24:

[0072] ATGGATAAGTATGTGCTCAGACCAAGCGACCCACATTTGTGGGCCATGTACAAGAAGGCCGTTGCGTCTTTTTGGACCGT

[0073] TGAGGAGGTGGATCTTAGTACTGATGTACGCCATTGGACAGAAAAACTGACCGAGGCTGAGCGCAGGTTCATGTCTCACA

[0074] TACTGGCATTCTTTGCAATGGCAGATGGCATTGTAGGCGACAACCTTGTGTGCAATTTCGCAAAAGAACTTGACTATATT

[0075] CCAGAAGCCAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
weightaaaaaaaaaa
Login to View More

Abstract

The present invention proposes a fish infectious spleen-kidney necrosis virus genetic engineering vaccine and a preparation method thereof. The genetic engineering vaccine proposed by the present invention contains two gene recombinant protein antigens protein-24 and protein-50, which are respectively screened from The two open reading frames ORF24 and ORF50 in the ISKNV genome were cloned, recombinant plasmids were prepared, and recombinant proteins were expressed. The vaccine is a recombinant protein vaccine that can inhibit the infection of infectious spleen and kidney necrosis virus to fish, so that aquatic fish can grow healthily, reduce the loss of aquaculture in terms of disease, increase aquatic production and efficiency, and avoid DNA vaccines The existing disadvantages.

Description

technical field [0001] The invention belongs to the field of biological genetic engineering, and in particular relates to a fish infectious spleen and kidney necrosis virus (ISKNV) genetic engineering vaccine and a preparation method thereof. Background technique [0002] With the continuous development of my country's aquaculture industry, various aquaculture areas and aquaculture densities continue to increase. At the same time, improper management techniques in aquaculture make the aquaculture water environment deteriorating day by day, and various diseases frequently break out. Among the many diseases reported so far, one of the main causes of serious economic losses to fish farming is viral diseases. Among them, Infectious Spleen and Kidney Necrosis Virus (ISKNV, Infectious Spleen and Kidney Necrosis Virus) is one of the main viruses that cause a large number of fish deaths. [0003] The diameter of the mature virion of this virus is 150nm. Infected cells are swollen,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/12A61P31/12C12N15/33
Inventor 何建国张旻翁少萍
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com