antibody against tenascin c

A tenascin and tenascin technology, applied in the field of human antibodies against tenascin C, can solve the problems of epitope and antibody specificity or insufficient stability

Inactive Publication Date: 2015-11-25
PHILOGEN SRL LLC
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Possible reasons for inability to bind in vivo include post-translational modification of the epitope, thereby masking the epitope and insufficient antibody specificity or stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • antibody against tenascin c
  • antibody against tenascin c
  • antibody against tenascin c

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0171] The gene encoding domain A1 of human tenascin C was cloned from mRNA by RT-PCR, specifically normal human dermal fibroblasts (NHDF) cultured at pH 7.5 in the absence of serum [16], by PCR , the mRNA was isolated from the cells using oligomeric TnC-AlBamHIba (cgggatcctccactgaacaagcccctgag) and TnC-A1BglIIforggagatctttcccctgtggaggcctcagc). The gene was then cloned into the pQE12 bacterial expression vector (Qiagen) and expressed in E. coli TG-1. Purification was performed by His-tag using nickel-loaded Ni-NTA agarose resin (Qiagen).

[0172] Purified domain Al was biotinylated prior to selection using Sulfo-NHS-SS-Biotin (Pierce). Biopanning was performed as described (VitiF, et al. Methods Enzymol 2000; 326:480-505). Briefly, biotinylated proteins (final concentration 10 -7 M) Incubate with 600 [mu]l pre-blocked ETH-2 library phage for 30 minutes. By adding 5.3×10 -7 Streptavidin-coated magnetic beads (Dynal) capture bound phage. After strong washing, the selected ...

Embodiment 2

[0183] The gene encoding domain C of human tenascin C was cloned into the vector pQE12 (Qiagen) [Carnemolla B et al AmJ Pathol 1999; 154: 1345-1352, Balza E et al FEBS Lett 1993; 332: 39-43] and expressed in E. coli TG-1. Purification was performed by His-tag using nickel-loaded Ni-NTA (Qiagen).

[0184] Purified domain C was biotinylated prior to selection using Sulfo-NHS-SS-Biotin (Pierce). Bioscreens were performed as described [VitiF, et al. Methods Enzymol 2000; 326: 480-505], but using alternate screening protocols on streptavidin and avidin coated plates. Briefly, biotinylated proteins (final concentration 10 -7 M) Incubate with 600 [mu]l pre-blocked ETH-2 library phage for 30 minutes. Bound phage were captured on plastic microtiter plates coated with avidin (1st and 3rd incubation cycles) or streptavidin (2nd incubation cycle). After extensive washing, selected phage were eluted by reducing the disulfide bond in the biotin linker. Isolated phage were amplified in T...

Embodiment 3

[0189] Using a similar protocol as described in Example 2, scFvs against the C domain of tenascin C were further isolated and named F4 and G11, respectively. F4 and G11 have two VL domains that differ in amino acids and have the same VH domain. The VH and VL domains are connected by a peptide linker having an amino acid sequence as shown in SEQ ID NO: 37 or SEQ ID NO: 39 encoded by SEQ ID NO: 36 or SEQ ID NO: 38, respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Specific binding members against extracellular matrix protein tenascin-C, especially scFv antibody molecules against domain A1, domain C and domain D of tenascin-C. Anti-tenascin-C specific binding members conjugated with labels, cytotoxic molecules or cytokines. Use of anti-tenascin-C specific binding members in diagnosis and treatment, especially of cancer.

Description

technical field [0001] The present invention relates to specific binding members directed against tenascin-C, in particular human antibodies against tenascin-C. These specific binding members have a range of therapeutic applications, for example in the diagnosis and treatment of cancer. Background technique [0002] Tenascin C is a hexameric glycoprotein of the extracellular matrix that regulates cell adhesion. It is involved in processes such as cell proliferation and cell migration, and is associated with structural changes in tissues as they occur during morphogenesis and embryogenesis, as well as in tumorigenesis or angiogenesis. [0003] The schematic domain structure of tenascin C is shown in figure 1 shown. Several isoforms of tenascin C can be produced as a result of alternative splicing that can lead to inclusion(s) in the central portion of this protein from domain A1 to domain D domains [Borsi L et al IntJ Cancer 1992; 52:688-692, Carnemolla B et al EurJ Bioch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/28C12N15/13A61K39/395A61P35/00
CPCA61K47/48561A61K47/48569A61K2039/505C07K16/28C07K2317/21C07K2317/565A61K47/6849A61K47/6851A61P35/00C07K16/00
InventorS·布拉克M·西拉齐D·内里
OwnerPHILOGEN SRL LLC