Production of recombinant proteins by autoproteolytic cleavage of a fusion protein

A technology of protease and fusion polypeptide, which is applied in the field of heterologous polypeptides, can solve the problems of not allowing the formation of Npro to refold the environment, not being suitable for use, and being unable to use Npro, etc.

Active Publication Date: 2008-06-11
SANDOZ AG +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Also, some processes do not allow the formation of N pro The renaturation environment makes it impossible to use N in this process pro
Therefore, natural pestiviruses N pro May not be suitable for the preparation of some desired polypeptides or for use in certain circumstances

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0167] Use the sequence N of SEQ ID NO 5 (EDDIE) pro Derivatives of , by refolding to prepare the desired heterologous polypeptide (insulin)

[0168] 1.1 Preparation of derivatives

[0169] 1.1.1 PCR mutation

[0170] contains N pro The structure of the DNA sequence of -pro-insulin (SEQ ID NO 6):

[0171] ATGGAACTCAATCATTTCGAACTGCTCTACAAAACTAGCAAGCAAAAAACCTGTTGGCGT

[0172] TGAAGAGCCGGTCTACGATACTGCAGGTCGTCCTCTTTTTGGGAATCCGTCCGAAGTG

[0173] CACCCCCAGTCAACCCTCAAGCTTCCCCATGACCGCGGACGCGGTGACATTCGTACAA

[0174] CGCTGCGCGATCTGCCTCGTAAAGGCGATTGTCGCTCTGGAAACCACCTAGGTCCGGT

[0175] GTCGGGCATTTACATTAAACCAGGTCCCGTCTATTACCAAGACTACACTGGTCCGGTTT

[0176] ACCATCGTGCACCTCTGGAATTCTTTGATGAAGCTCAATTTTGCGAAGTGACTAAACGT

[0177] ATTGGCCGTGTAACCGGTTCGGACGGGAAACTGTACCACATCTACGTGTGCGTTGATG

[0178] GCTGTATCCTGCTGAAACTCGCGAAGCGCGGAACCCTCGCACCCTGAAATGGATCCG

[0179] TAACTTCACTAACTGTCCACTGTGGGTCACTAGTTGCTTCGTTAACCAACATCTGTGCG

[0180] GTTCACACCCTTGTGGAAGCCCTGTATCTGGTGTGTGGCGAACGCGGATTCTTTTAT...

Embodiment 2

[0200] determination of solubility

[0201] 800 ml of a pellet of E. coli BL21(DE3) culture was transformed with EDDIE-6H-pET30a (see 1.1.2 for its construction) according to the method described in 4.3. The pellet was suspended in 40ml / g of lysis buffer (lysis-buffer) (20mM Na 2 HPO 4 , 75mM NaCl, 5mM EDTA, 2mM MgCl 2 , 10 mM 2-mercaptoethanol, pH 8). It was passed through the pressure cell (1380 bar) twice to achieve lysis of the cells. After using 1% Triton X-100 (dissolved in the lysis buffer of 5ml / g) to carry out the cultivation of 15min, under the condition of 25000g, the centrifugation was carried out to the cell homogenate for 45min, the supernatant was removed and the inclusion body ( IB) Store at -20°C. The inclusion bodies were dissolved in a guanidine chloride solution (5M GuCl, 102mM Tris, 25mM DTT, pH 7.5) at a concentration of 1.3ml / g, incubated at room temperature for 3.5h and the solution was incubated at 25000g Centrifuged for 15 min. Dilute the super...

Embodiment 3

[0203] Using N having the sequence of SEQ ID NO 2, 3 or 4, respectively pro One of the derivatives, the desired heterologous polypeptide (insulin) is prepared by refolding

[0204] For the derivatives respectively having the sequence of SEQ ID NO 2, 3 or 4, each step of the method is similar. The formation of the derivative is achieved according to the results of the derivative whose sequence is SEQ ID NO 5 (see Example 1).

[0205] 3.1 Preparation of derivatives

[0206] 3.1.1 PCR mutation

[0207] The method is performed similarly to that described in 1.1.1.

[0208] 3.1.2 PCR amplification of mutants

[0209] The method is performed similarly to that described in 1.1.2.

[0210] 3.2 Preparation of plasmid

[0211] The procedure is performed similarly to that described in 4.1.

[0212] 3.3 Transformation of host cells

[0213] The method is performed similarly to that described in 4.2 below.

[0214] 3.4 Expression and fermentation

[0215] The procedure is carried o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a process for the recombinant production of a heterologous polypeptide of interest, comprising, (i) cultivation of a bacterial host cell which is transformed with an expression vector which comprises a nucleic acid molecule which codes for a fusion polypeptide, the fusion polypeptide comprising a derivative of an autoprotease N of Pestivirus, wherein at least one cysteine residue of the naturally occuring autoprotease N of Pestivirus is replaced by another amino acid residue, and a second polypeptide which is connected to the first polypeptide at the C-terminus of the first polypeptide in a manner such, that the second polypeptide is capable of being cleaved from the fusion polypeptide by the autoproteolytic activity of the first polypeptide, said second polypeptide being a heterologous polypeptide, wherein cultivation occurs under conditions which cause expression of the fusion polypeptide and formation of corresponding cytoplasmic inclusion bodies, (ii) isolation of the inclusion bodies from the host cell, (iii) solubilization of the isolated inclusion bodies, (iv) induction of autoproteolytic cleavage of the heterologous polypeptide of interest from the fusion polypeptide, and (v) isolation of the cleaved heterologous polypeptide of interest.

Description

technical field [0001] The present invention relates to a method for the recombinant production of a desired heterologous polypeptide having a specific homologous N-terminus in a bacterial host cell, which method requires first producing a fusion polypeptide in the host cell by expression, the fusion polypeptide comprising Virus N pro Derivatives of self proteases and desired heterologous polypeptides. The desired heterologous polypeptide is produced in the host cell as cytoplasmic inclusion bodies, which are isolated and processed in such a way that passage through N pro Autoproteolytic activity can cleave the desired heterologous polypeptide from the fusion polypeptide. Background technique [0002] When preparing recombinant proteins in heterologous organisms, such as human proteins or eukaryotic proteins in other bacterial cells, it is often difficult to obtain a specific N-terminus that is almost 100% homologous. This situation exists especially in recombinant pharma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N9/50C12P21/06
InventorF·韦特C·阿赫谬勒P·威时纳B·奥尔S·珀德米尔塞格
OwnerSANDOZ AG