Production of recombinant proteins by autoproteolytic cleavage of a fusion protein
A technology of protease and fusion polypeptide, which is applied in the field of heterologous polypeptides, can solve the problems of not allowing the formation of Npro to refold the environment, not being suitable for use, and being unable to use Npro, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0167] Use the sequence N of SEQ ID NO 5 (EDDIE) pro Derivatives of , by refolding to prepare the desired heterologous polypeptide (insulin)
[0168] 1.1 Preparation of derivatives
[0169] 1.1.1 PCR mutation
[0170] contains N pro The structure of the DNA sequence of -pro-insulin (SEQ ID NO 6):
[0171] ATGGAACTCAATCATTTCGAACTGCTCTACAAAACTAGCAAGCAAAAAACCTGTTGGCGT
[0172] TGAAGAGCCGGTCTACGATACTGCAGGTCGTCCTCTTTTTGGGAATCCGTCCGAAGTG
[0173] CACCCCCAGTCAACCCTCAAGCTTCCCCATGACCGCGGACGCGGTGACATTCGTACAA
[0174] CGCTGCGCGATCTGCCTCGTAAAGGCGATTGTCGCTCTGGAAACCACCTAGGTCCGGT
[0175] GTCGGGCATTTACATTAAACCAGGTCCCGTCTATTACCAAGACTACACTGGTCCGGTTT
[0176] ACCATCGTGCACCTCTGGAATTCTTTGATGAAGCTCAATTTTGCGAAGTGACTAAACGT
[0177] ATTGGCCGTGTAACCGGTTCGGACGGGAAACTGTACCACATCTACGTGTGCGTTGATG
[0178] GCTGTATCCTGCTGAAACTCGCGAAGCGCGGAACCCTCGCACCCTGAAATGGATCCG
[0179] TAACTTCACTAACTGTCCACTGTGGGTCACTAGTTGCTTCGTTAACCAACATCTGTGCG
[0180] GTTCACACCCTTGTGGAAGCCCTGTATCTGGTGTGTGGCGAACGCGGATTCTTTTAT...
Embodiment 2
[0200] determination of solubility
[0201] 800 ml of a pellet of E. coli BL21(DE3) culture was transformed with EDDIE-6H-pET30a (see 1.1.2 for its construction) according to the method described in 4.3. The pellet was suspended in 40ml / g of lysis buffer (lysis-buffer) (20mM Na 2 HPO 4 , 75mM NaCl, 5mM EDTA, 2mM MgCl 2 , 10 mM 2-mercaptoethanol, pH 8). It was passed through the pressure cell (1380 bar) twice to achieve lysis of the cells. After using 1% Triton X-100 (dissolved in the lysis buffer of 5ml / g) to carry out the cultivation of 15min, under the condition of 25000g, the centrifugation was carried out to the cell homogenate for 45min, the supernatant was removed and the inclusion body ( IB) Store at -20°C. The inclusion bodies were dissolved in a guanidine chloride solution (5M GuCl, 102mM Tris, 25mM DTT, pH 7.5) at a concentration of 1.3ml / g, incubated at room temperature for 3.5h and the solution was incubated at 25000g Centrifuged for 15 min. Dilute the super...
Embodiment 3
[0203] Using N having the sequence of SEQ ID NO 2, 3 or 4, respectively pro One of the derivatives, the desired heterologous polypeptide (insulin) is prepared by refolding
[0204] For the derivatives respectively having the sequence of SEQ ID NO 2, 3 or 4, each step of the method is similar. The formation of the derivative is achieved according to the results of the derivative whose sequence is SEQ ID NO 5 (see Example 1).
[0205] 3.1 Preparation of derivatives
[0206] 3.1.1 PCR mutation
[0207] The method is performed similarly to that described in 1.1.1.
[0208] 3.1.2 PCR amplification of mutants
[0209] The method is performed similarly to that described in 1.1.2.
[0210] 3.2 Preparation of plasmid
[0211] The procedure is performed similarly to that described in 4.1.
[0212] 3.3 Transformation of host cells
[0213] The method is performed similarly to that described in 4.2 below.
[0214] 3.4 Expression and fermentation
[0215] The procedure is carried o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More