Unlock instant, AI-driven research and patent intelligence for your innovation.
Highly pathogenic PRRS virus recombinant plasmid and genetic engineering vaccines
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of porcine PRRS virus and PRRS virus, applied in antiviral agents, genetic engineering, virus/bacteriophage, etc., to achieve high immune protection rate and good safety effect
Active Publication Date: 2008-06-25
BOEHRINGER INGELHEIM (CHINA) INVESTMENT CO LTD
View PDF0 Cites 8 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0006] The structural proteins of PRRSV constitute round-shaped and enveloped virus particles. Among them, the products encoded by ORF5, ORF6 and ORF7 are essential viral proteins, while other glycoproteins GP2, GP3, GP4, etc. The role of the process is still controversial
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0041] Example 1 , Construction of highly pathogenic PRRS virus recombinant plasmid
[0042] According to the nucleotide sequence of the highly pathogenic PRRS virus gene JX143 whose GenBank accession number is EF488048, design 5 pairs of primers, respectively as the primers of PCR amplification; Extract highly pathogenic virus RNA from the wild strain, reverse transcribe and synthesize it into wild strain cDNA, use it as a template for PCR, carry out PCR amplification, obtain 5 specific fragments 1-5 of wild strain cDNA, and divide the 5th Mutate the specific fragment to obtain the specific fragment 5'; then insert the specific fragment 1-5 or the specific fragment 1-4+5' into the pBlueScriptII SK(+) vector in sequence to construct recombinant plasmids pJX143 and pJX143 -M, the process is shown in Figure 3, and then through cell experiments and animal experiments, it was verified that the obtained recombinant plasmid has high pathogenicity, the specific process is as follows...
Embodiment 2
[0097] Example 2 , PRRS Chimeric Virus Construction and Detection
[0098] 2.1. Primer design
[0099] According to the sequence of pJX143 strain, design primers SPEF, NDE5F, Qst, SRSOE6, SFSOE7, SF12670, SR14365, SF14413 and SR15497, its sequence and sequence description are shown in Table 1:
[0100] Table 1. Primers used for cloning and sequencing
[0101] name
Sequence (5'-3')
purpose
SPEF
GCCACTTGACTAGTGTTTACG
Located at the end of ORF3, containing a SpeI site, cloned upstream
Primers for construction of pSX12, p56N12
NDE5F
CTGTTGGCAGTTTGACATATGTTTAAGTATG
Located between ORF4 and ORF5, containing Nde I site,
Cloning of upstream primers for construction of p5NX12
Qst
GAGTGACGAGGACTCGAGCGCATGCTTTTTT
TTTTTTT
Reverse transcription primer; cloning downstream primer, containing XhoI site
[0151] 3.1 Selection and grouping of experimental pigs
[0152] Ten healthy piglets at the age of 29 days were selected, and the serum was collected for PRRSV antibody and antigen detection. They were determined to be negative for PRRSV antibody and antigen. After weighing, they were randomly divided into 2 groups, 5 piglets / group, and kept in isolation.
[0154] Select TCID 50 for 10 6.0 The Marc-145 cell culture of the PRRSV SX12 strain virus, after doing 100-fold dilution with sterilized PBS liquid, inoculate a group of 5 test piglets in the neck muscle, 104.0 TCID 50 / ml, 2ml / head; another group of 5 pigs was inoculated with sterilized PBS solution in the neck muscles as a control, 2ml / head.
[0155] 3.3 Challenge virus after PRRS chimeric virus immunization
[0156] 28 days after the inoculation of the PRRSV SX12 strain virus, the piglets of the test group w...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a construction method for highly pathogenicporcine reproductive and respiratory syndrome virus recombinant plasmids, and a genetic engineering vaccine which is constructed according to the recombinant plasmids and a construction method thereof, wherein, a plurality of pairs of primers are designed according to sequences of relative conservative regions of a reproductive and respiratory syndrome virusgene; reproductive and respiratory syndrome virusgene sequences are amplified in a sectional type and then connected to proper vectors in turn, and then the reproductive and respiratory syndrome virus recombinant plasmids are obtained. The vaccine is a lentogen vaccine strain wherein sequences of coding structural proteins and 3'UTR genes are respectively replaced by sequences of corresponding coding structural proteins and 3'UTR genes of the recombinant plasmids. By utilization of the construction method for the recombinant plasmids of the invention, a vaccine strain which is similar to a wild parent strain can be constructed. Simultaneously, the vaccine strain constructed on the basis of the recombinant plasmids has the advantages of good safety to pig bodies, capability of effectively inducing and generating body immunity after immune, providence of pig body immune protection, and immune protection rate on 'highly pathogenicporcine reproductive and respiratory syndrome virus' raching 100 percent.
Description
technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to a virus recombinant plasmid and a genetic engineering vaccine, and more specifically relates to a highly pathogenic porcine blue ear diseasevirus recombinant plasmid and a genetic engineering vaccine. Background technique [0002] Porcine Reproductive and Respiratory Syndrome (PRRS), also known as PRRS, is a highly contagious disease caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). The PRRSV genome is a single-stranded positive-sense RNA with a size of about 15 kb and no segments. Because RNA viruses are prone to genetic and antigenic mutations, PRRSV mutants with enhanced pathogenicity have emerged around the world in recent years. In addition, because the target cells of PRRSV are alveolar macrophages, one of the important members of the immune system, most of the infected pigs show immunity. Inhibition caused secondary infection and mixed infec...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More