Pre-T carrier, preparation thereof and applications
A carrier and resistance gene technology, applied in the field of pre-T carrier, can solve the problems of troublesome preparation of blue-white screening plate, inability to guarantee the end of carrier molecule, high price, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Example 1: Construction of restriction restriction cassettes
[0028] Using pET28 (or pET39) as a template, use the following two primers for PCR reaction:
[0029] P1 (Forward):
[0030] 5'XXXGGATCCAAGGGTATAATGGGCCTAACTACGGCTACACTA3'
[0031] P2 (Reverse):
[0032] 5'CTCAAGCTTCCAAGGGTATAATGGACCCCCTATTTGTTTATTTTT3'
[0033] The reaction parameters are as follows:
[0034] Pre-denaturation at 94°C for 3 minutes, denaturation at 94°C for 30s, annealing at 45°C for 30s, extension at 72°C for 90s, three cycles; then denaturation at 94°C for 30s, extension at 72°C for 90s, 27 cycles
[0035] Enzyme; Taq Plus DNA polymerase
Embodiment 2
[0036] Embodiment 2: the preparation of former T carrier
[0037] The PCR product of Example 1 is connected to the pUCm-T carrier supplied on the market, and the connection system is as follows:
[0038] PCR product 1uL
[0039] pUCm-T 1uL
[0040] 10×T4 DNA ligase buffer 3uL
[0041] T4 DNA ligase 1uL
[0042] wxya 2 O 24uL to 30uL total volume
[0043] Connect at 14-16°C for more than 10 hours to transform E.coli DH5α (or JM109).
Embodiment 3
[0044] Embodiment 3: Preparation of T carrier
[0045] The positive transformant plasmid of Example 2 was extracted by the alkali-SDS method, purified by a plasmid DNA recovery kit, and digested with XcmI. The enzyme digestion system is as follows:
[0046] Plasmid 2uL
[0047] 10×NEB buffer 2uL
[0048] XcmI(5u / uL) 0.5uL
[0049] wxya 2 O to a total volume of 20uL
[0050] Enzyme digestion reaction at 37°C for more than 2 hours, the carrier DNA fragment and the DNA fragment containing the kana resistance gene were separated by 0.8% agarose gel electrophoresis, and the large fragment DNA was recovered by cutting the gel to obtain the T for rapid cloning of the target PCR product. carrier.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More