Supercharge Your Innovation With Domain-Expert AI Agents!

Test paper strip for rapidly detecting lept specificity antibody colloidal gold

A technology for detecting spirochetes and test strips, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as inability to achieve early diagnosis, achieve the effects of saving manpower and material resources, clear and easy to distinguish results, and simple operation

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] The above-mentioned tests all use known leptospira antigens to detect the corresponding antibodies in the blood, and cannot achieve early diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for rapidly detecting lept specificity antibody colloidal gold
  • Test paper strip for rapidly detecting lept specificity antibody colloidal gold
  • Test paper strip for rapidly detecting lept specificity antibody colloidal gold

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Clonal expression of embodiment 1 Leptospira specific antigen ompL1 and LipL32

[0036] (1) Amplification of ompL1 (accession number EU022021) and LipL32 (accession number AM936999) genes

[0037] Design primers based on the sequence of the target gene fragment:

[0038] LipL32 primer sequence

[0039] 5'GCCGAATTCATGAAAAAACTTTCGATTTTG3'

[0040] 5'GCCCTCGAGTTACTTAGTCGCGTCAGAAGC3'

[0041] PCR parameters: 95°C for 5min; 95°C for 1min, 50°C for 30s, 70°C for 1min, 30 cycles; finally 70°C extension for 10min.

[0042] ompL1 primer sequence

[0043] 5'GCCGATATCATGAGAAAATTATCTTCTCTA3'

[0044] 5'GCACTCGAGTTACTTTGCGTTGCTTTCGTC3'

[0045] PCR parameters: 95°C for 5min; 95°C for 1min, 55°C for 30s, 72°C for 1min, 30 cycles; finally 72°C extension for 10min.

[0046] (2) Cloning of the target gene and screening of positive recombinants

[0047]After electrophoresis, the two PCR amplification products were recovered by gel cutting, connected with the PMD-18T cloning vecto...

Embodiment 2

[0057] Example 2 Preparation of ompL1 and LipL32 polyclonal antibodies

[0058] (1) Animal immunity:

[0059] New Zealand white rabbits weighing 1-2 kg were selected, and ompL1 protein was injected subcutaneously at multiple points on the back, and the immunization dose was 1 mg / kg. A total of 4 times of immunization.

[0060] (2) Immunological titer detection:

[0061] A microtiter plate coated with ompL1 protein, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. Serum can be collected when the titer of serum reaches above 1:20000.

[0062] (3) Antibody purification and verification:

[0063] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity was tested by ELISA, and the titer was greater than 1:20000.

[0064] The preparation of LipL32 polyclonal antibody is the same as that of ompL1

Embodiment 3

[0065] Example 3 Leptospira antibody colloidal gold rapid detection test strip (see Figure 1)

[0066] (1) Preparation of colloidal gold-antigen conjugate:

[0067] It was determined by experiments that the optimal binding pH of the colloid-labeled mixed expressed protein (ompL1 and LipL32 mixed at 1:1) was 8.4, and the ratio of colloidal gold and antigen was 50 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.

[0068] (2) Coating antigen on nitrocellulose membrane:

[0069] The mixed expressed proteins (ompL1 and LipL32 mixed at 1:1) were diluted to 3mg / ml with 0.01M PBS. Polyclonal antibodies against ompL1 and LipL32 were diluted to 2 mg / ml with 0.01 M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for rapid detection of a leptospira antibody, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with Leptospira specific antigen ompL1 and LipL32, and a quality control band of polyclonal antibody coated with rabbit anti-Lebtospira specific antigen. The conjugate release pad is coated with colloidal gold labeled Leptospira specific antigens ompL1 and LipL32, and a membrane chromatography double antigen sandwich method is adopted to detect the Leptospira specific antigens ompL1 and LipL32 in a specimen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base and site detection and epidemiological investigation, and has auxiliary effect on the diagnosis of leptospiral infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a Leptospira-specific antibody detection test strip and an application thereof. Background technique [0002] Leptospirosis is an acute infectious disease caused by pathogenic Leptospira (abbreviated as Leptospira). Rodents, pigs and other livestock are the main sources of infection. Leptospira is excreted with the urine of bacteria-carrying animals and pollutes water sources. When people come into contact with infected water, they are infected through the skin and mucous membranes. The onset is mostly in the summer and autumn rice harvesting season or after heavy rain and flood. After a person is infected with leptospirosis, the incubation period is usually 1 to 3 weeks. First, sepsis is formed, which may have various clinical manifestations, including common type, pulmonary hemorrhage type, icteric hemorrhage type, and meningoencephalitis type. About 1 week a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More