Test paper strip for rapidly detecting lept specificity antibody colloidal gold
A technology for detecting spirochetes and test strips, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as inability to achieve early diagnosis, achieve the effects of saving manpower and material resources, clear and easy to distinguish results, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Clonal expression of embodiment 1 Leptospira specific antigen ompL1 and LipL32
[0036] (1) Amplification of ompL1 (accession number EU022021) and LipL32 (accession number AM936999) genes
[0037] Design primers based on the sequence of the target gene fragment:
[0038] LipL32 primer sequence
[0039] 5'GCCGAATTCATGAAAAAACTTTCGATTTTG3'
[0040] 5'GCCCTCGAGTTACTTAGTCGCGTCAGAAGC3'
[0041] PCR parameters: 95°C for 5min; 95°C for 1min, 50°C for 30s, 70°C for 1min, 30 cycles; finally 70°C extension for 10min.
[0042] ompL1 primer sequence
[0043] 5'GCCGATATCATGAGAAAATTATCTTCTCTA3'
[0044] 5'GCACTCGAGTTACTTTGCGTTGCTTTCGTC3'
[0045] PCR parameters: 95°C for 5min; 95°C for 1min, 55°C for 30s, 72°C for 1min, 30 cycles; finally 72°C extension for 10min.
[0046] (2) Cloning of the target gene and screening of positive recombinants
[0047]After electrophoresis, the two PCR amplification products were recovered by gel cutting, connected with the PMD-18T cloning vecto...
Embodiment 2
[0057] Example 2 Preparation of ompL1 and LipL32 polyclonal antibodies
[0058] (1) Animal immunity:
[0059] New Zealand white rabbits weighing 1-2 kg were selected, and ompL1 protein was injected subcutaneously at multiple points on the back, and the immunization dose was 1 mg / kg. A total of 4 times of immunization.
[0060] (2) Immunological titer detection:
[0061] A microtiter plate coated with ompL1 protein, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. Serum can be collected when the titer of serum reaches above 1:20000.
[0062] (3) Antibody purification and verification:
[0063] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity was tested by ELISA, and the titer was greater than 1:20000.
[0064] The preparation of LipL32 polyclonal antibody is the same as that of ompL1
Embodiment 3
[0065] Example 3 Leptospira antibody colloidal gold rapid detection test strip (see Figure 1)
[0066] (1) Preparation of colloidal gold-antigen conjugate:
[0067] It was determined by experiments that the optimal binding pH of the colloid-labeled mixed expressed protein (ompL1 and LipL32 mixed at 1:1) was 8.4, and the ratio of colloidal gold and antigen was 50 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.
[0068] (2) Coating antigen on nitrocellulose membrane:
[0069] The mixed expressed proteins (ompL1 and LipL32 mixed at 1:1) were diluted to 3mg / ml with 0.01M PBS. Polyclonal antibodies against ompL1 and LipL32 were diluted to 2 mg / ml with 0.01 M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm wi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com