Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same

A Clostridium difficile and detection test paper technology, which is applied in the field of Clostridium difficile A and B toxin colloidal gold detection test strips, can solve the problems of cumbersome operation and long time, and achieve simple operation, clear and easy to distinguish results, and easy promotion Effect

Active Publication Date: 2012-12-19
辽宁迪浩生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above methods all have the disadvantages of requiring professionals in a specific laboratory, certain equipment and instruments, cumbersome operation, and long time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same
  • Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same
  • Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Preparation of Genetic Engineering Antigen of Clostridium difficile A Toxin

[0040] (1) Obtaining the target gene

[0041] According to the target gene fragment sequence (GenBank accession number is NC009012) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, design primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends:

[0042]5'TCCGAATTGGGCCTCAACTGGTTATACAAGT 3'

[0043] 5'GTGCTCGAGAGGGGCTTTTACTCCATCAAC3'

[0044] Then, the target gene fragment was amplified from the genome, and the amplification conditions were: denaturation at 95°C for 5 minutes; 35 cycles at 95°C for 1 minute, 1 minute at 49.8°C, and 1 minute at 70°C; finally, extension at 70°C for 10 minutes.

[0045] (2) Cloning of the target gene and screening of positive recombinants

[0046] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°C, transformed into D...

Embodiment 2

[0055] Example 2: Preparation of Clostridium difficile B toxin genetically engineered antigen

[0056] (1) Amplification of the target gene

[0057] Refer to the Cd VPI10463 gene sequence included in GenBank, design primers, and add a suitable restriction endonuclease cutting site at its 5' end:

[0058] Upstream primer: 5'TCCGAATTCGCTTATGTCAACTAGTGAA 3'

[0059] Downstream primer: 5'GCACTCGAGTTCACTA ATCACT AATTC 3'

[0060] The total reaction system is 50ul: upstream primer (20pmol / L) 1ul, downstream primer (20pmol / L) 1ul, bacterial DNA template 2ul, dd H20 44ul, add to PCR amplification tube (PCR buffer, pfu enzyme and d NTPs have been added) . Reaction conditions: Denaturation at 94°C for 45s, annealing at 60°C for 60s, extension at 72°C for 150s, after 39 cycles, extension at 72°C for 10min. The amplification results were observed by 1% agarose gel electrophoresis.

[0061] (2) Cloning of the target gene and screening of positive recombinants

[0062] After electroph...

Embodiment 3

[0071] Example 3 Development of Clostridium difficile A toxin monoclonal antibody

[0072] (1) Immunized mice

[0073] A toxin genetically engineered antigen was taken out from the -20°C low-temperature refrigerator and dissolved, and then subcutaneously injected into the back of BALB / C mice (0.2ml / mouse) with an interval of 10 days. Three days before the fusion, mice were challenged with 0.15 ml of antigen in the peritoneal cavity. The immune effect was detected by ELISA method.

[0074] (2) Myeloma cells

[0075] SP2 / 0 myeloma cells: Resuscitate the SP2 / 0 cells stored in the liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours. Uniform, neatly arranged, logarithmically split, ready for fusion.

[0076] (3) cell fusion

[0077] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weight 1500...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a test strip for rapid detection of clostridium difficile toxins A and B. A monoclonal antibody or polyclonal antibody of the clostridium difficile toxin A, a monoclonal antibody or polyclonal antibody of the clostridium difficile toxin B, and a quality control double-antibody IgG coat a nitrate cellulose film (NC film), and a membrane chromatography double antibody sandwich method is adopted to detect the clostridium difficile toxins A and B in a specimen in combination with a monoclonal antibody of colloidal gold labeled clostridium difficile toxins A and B. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, site detection and epidemiological investigation, and has auxiliary effect on the diagnosis of clostridium difficile toxin infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a colloidal gold detection test strip for Clostridium difficile A and B toxins, a preparation method and an application thereof. Background technique [0002] Clostridium difficile (Clostridium difficile) is an anaerobic bacteria, is a member of the genus Clostridium. The Clostridium genus can be divided into several groups, several of which are pathogenic to humans, the most notable being Clostridium perfringens, Clostridium tetani, and Clostridium botulinum. Clostridium difficile is the causative agent of antibiotic-associated diarrhea and pseudomembranous colitis. [0003] The bacterium Clostridium difficile usually lives in the human gut. If the bacterial population grows too quickly due to an overdose of antibiotics, severe inflammation can result. This bacterium can cause pseudomembranous colitis, and 90-95% of patients with pseudomembranous colitis can de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/545
Inventor刘明
Owner辽宁迪浩生物科技有限公司