High temperature and strong alkali resistant xylanase improved gene, genetic engineering bacterial strain thereof and preparation method thereof

A technology for genetically engineered strains and xylanase, which is applied in the fields of genetic engineering and protein engineering, can solve the problems that the enzymatic properties cannot meet industrial production and application, and achieves the effects of satisfying the needs of industrial production and improving thermal stability.

Active Publication Date: 2009-03-25
FUDAN UNIV +1
View PDF0 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The optimum reaction temperature of these xylanases from natural sources is mostly around 50-60°C, and the optimum reaction pH value is mostly between 4.0-6.0 (Liu Liangwei et al., Henan Agricultural Science, 2006, Vol 6, 14-18) , its enzymatic properties often cannot meet the needs of industrial production and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High temperature and strong alkali resistant xylanase improved gene, genetic engineering bacterial strain thereof and preparation method thereof
  • High temperature and strong alkali resistant xylanase improved gene, genetic engineering bacterial strain thereof and preparation method thereof
  • High temperature and strong alkali resistant xylanase improved gene, genetic engineering bacterial strain thereof and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Obtaining improved xylanase gene by directed evolution technique

[0035] Design PCR primers XynF1 and XynR1 as follows:

[0036] XynF1: GGC GGATCC ATGCAAAGTTTCTGTAGTTCAGCTTCTCAC (forward primer, the underlined sequence is the recognition sequence for BamHI digestion), that is, SEQ ID NO 3.

[0037] XynR1: GCG GCGGCCGC ATCACCAATGTAAACCTTTGCGTAT (reverse primer, the underlined sequence is the NotI restriction recognition sequence, without stop codon, the expression is terminated by using the stop codon on the vector), that is, SEQ ID NO 4.

[0038] Using the Xyn-CDBFV gene as a template, the GeneMorph II Random Mutation PCR Kit (Stratagene) was used to perform PCR amplification with the above primers, and the PCR product was recovered from the gel, digested with BamHI and NotI, and then ligated with the PET21a vector after the same digestion , transformed into Escherichia coli BL21 (DE3), spread on LA plate (LB medium + 100 μg / ml ampicillin), and culture...

Embodiment 2

[0040] Example 2: Cysteine ​​at position 201 and position 50 in the improved xylanase forms a disulfide bond

[0041] The improved thermostability of the improved xylanase is due to the formation of a new disulfide bond between the 201-position and the 50-position cysteine.

[0042] The homology modeling of the improved xylanase (Xyn-CDBFV-G201C) was carried out in SWISS-MODEL (http: / / swissmodel.expasy.org / ), and it can be seen that the cysteines at positions 50, 60 and 201 are in They are close to each other in space, and it is possible to form disulfide bonds with each other, but the spatial positions of cysteines at position 201 and 50 make them easier to form disulfide bonds, so site-directed mutations were carried out on the original and improved xylanases, The cysteine ​​at position 60 was mutated to alanine. The original and improved xylanase genes and their C60A mutant genes were respectively cloned into PET21a, and these four enzyme proteins were prepared by recombin...

Embodiment 3

[0044] Example 3 Construction of recombinant yeast expression vectors containing improved genes and acquisition of recombinant yeast genetically engineered strains

[0045] The plasmid used to construct the yeast expression vector is pPIC9K (with alpha factor secretion signal), and the PCR primers XynF2 and XynR2 are designed as follows:

[0046] XynF2: GGC GAATTC ATGCAAAGTTTCTGTAGTTCAGCTTCTCAC (forward primer, the underlined sequence is the EcoRI restriction recognition sequence), that is, SEQ ID NO 5.

[0047] XynR2: GCG GCGGCCGC ATCACCAATGTAAACCTTTGCGTAT (reverse primer, the sequence underlined is the NotI restriction recognition sequence, and the sequence in the box is the stop codon), that is, SEQ ID NO 6.

[0048] Using PET21a-Xyn-CDBFV-G201C plasmid DNA as a template, use high-fidelity Pfu polymerase to amplify the Xyn-CDBFV-G201C fragment, clone it into pPIC9k, and form a recombinant plasmid pPIC9k-Xyn-CDBFV-G201C, the enzyme gene is in the AOX1 promoter downst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a modified coding gene of xylanase that has high activity in the condition of high temperature and strong alkali, a recombinant plasmid thereof, a yeast recombination genetic engineering strain containing the gene and a preparation method of the gene. Compared with the original xylanase, the modified xylanase is mutated into cysteine from glycin of the 201 site of amino acid sequence of the original xylanase; and the modified xylanase has higher heat stability, after being processed for 10 minutes at the temperature of 75 DEG C, the residual activity of the modified xylanase reaches 80 percent, while that of the original xylanase is only 15 percent. The activity of the modified xylanase is 1.5 to 2 times of that of the original xylanase at the environment with high temperature and strong alkali and can decompose xylan for a long time at high temperature. The invention also provides the Pichia pastoris yeast recombination genetic engineering strain containing the modified gene. The modified xylanase can be widely applied to industries of paper making, feedstuff and food.

Description

technical field [0001] The invention belongs to the field of genetic engineering and protein engineering, and relates to an improved gene encoding xylanase activity under high temperature and strong alkali, a carrier containing the improved gene, a genetic engineering strain, a method for preparing and expressing the gene, and preparation of the strain method. Background technique [0002] Xylanase [EC.3.1.2.8] hydrolyzes the β-1.4-glucosidic bonds in xylan molecules in an endo-cutting manner, and its hydrolyzed products are mainly xylobiose and xylooligosaccharides, which are used in pulp and paper, animal feed, food industry and The energy industry has great application prospects. Xylanase can be used as a pulp bleaching aid in the paper industry, which can not only improve the whiteness and strength of paper, but also reduce the discharge of chloride and hypochlorite from traditional bleaching agents, greatly reducing environmental pollution; adding it to animal feed Xy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N9/42C12N15/63C12N15/81C12N1/19C12N15/10C12R1/84
Inventor吕红游淳黄强
OwnerFUDAN UNIV