Transferrin-frog-egg ribonuclease coupler and production method and use thereof
A kind of ribonuclease and transferrin technology, which is applied in the field of transferrin-frog egg ribonuclease conjugate and preparation thereof
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0082] Preparation method of the conjugate
[0083] The inventor finds in research, adopts SPDP alone to prepare transferrin-frog egg ribonuclease conjugate as a coupling agent, the conjugate obtained is random, has different structures, and has a large difference in molecular weight. It is beneficial for purification, and the proportion of conjugates entering tumor cells is low.
[0084] The present inventor has carried out long-term research and improvement, has found a kind of method that can prepare transferrin-frog egg ribonuclease conjugate that meets the requirements, and described method comprises:
[0085] (1) utilizing N-hydroxysuccinimide 3-(2-pyridyldithio)propionate (SPDP) and 2-Iminothiolane HCl to couple transferrin and frog egg ribonuclease; and
[0086] (2) Separating and obtaining the transferrin-frog egg ribonuclease conjugate.
[0087] As a preferred mode of the present invention, the method includes:
[0088] (a) Contact transferrin with N-hydroxysuccin...
Embodiment 1
[0108] Embodiment 1 Onc protein preparation
[0109] 1. Construction of expression Onc plasmid
[0110] According to the sequence shown in SEQ ID NO: 3, the coding sequence of Onc protein was synthesized from the whole sequence, and the primers at both ends were designed as follows:
[0111] The 5' primer is: CCCAGGACTGGCTGACTTTCCA (SEQ ID NO: 5);
[0112] The 3' primer is: AAAGTCGACTCAGCAAGAACCAACACC (SEQ ID NO: 6);
[0113] Using the previously synthesized gene sequence as a template and using SEQ ID NO: 5 and SEQ ID NO: 6 as primers, PCR amplification was carried out, and the amplified product was cloned into the MscI and Between the SalI sites, an expression plasmid capable of expressing Onc was obtained.
[0114] 2. Onc protein expression
[0115] The previously constructed expression plasmid was transformed into Escherichia coli BL21(DE3), and a single clone was picked overnight in 50 ml LB medium and cultured overnight at 37°C. The next day, transfer 1 LTB medium a...
Embodiment 2
[0127] Example 2 Preparation of transferrin Tf and ribonuclease Onc conjugate
[0128] A. Coupling with SPDP and 2-Iminothiolane
[0129] 1. Tf (purchased from CALBIOCHEM, batch number is Cat: 616397, powder, its amino acid sequence such as SEQ ID NO: 2) is dissolved in PBS (pH7.4) to make the final concentration 20mg / ml, add 50 μ l (equivalent to According to the molar ratio of about 10 times of Tf) 50mM SPDP, mixed quickly, reacted for 30min, separated with desalting column HiTrap Desalting (5×5ml, Pharmacia), mobile phase was PBS (pH7.4), collected step by step , 10% SDS-PAGE test results, set aside egg samples for future use.
[0130] 2. Dissolve the previously prepared and purified Onc protein in 20mM phosphate buffer (pH6.0) so that the final concentration is 1mg / ml, add 16.67μl of 50mM 2-Iminothiolane HCl (Promega, equivalent to about 10 times the amount of Onc), mixed quickly, and after 1 hour of reaction, dialyzed to remove small molecules.
[0131] 3. Mix Onc and Tf...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
