Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transferrin-frog-egg ribonuclease coupler and production method and use thereof

A kind of ribonuclease and transferrin technology, which is applied in the field of transferrin-frog egg ribonuclease conjugate and preparation thereof

Active Publication Date: 2009-06-10
SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the protein is a non-human protein, it will still produce certain immune reactions and side effects (such as kidney damage) when used in the human body. At the same time, Onc also has a certain killing effect on some normal cells. To overcome these shortcomings, it is necessary to It is necessary to enhance the specific killing effect of Onc on tumor cells and improve the efficiency of Onc entering tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transferrin-frog-egg ribonuclease coupler and production method and use thereof
  • Transferrin-frog-egg ribonuclease coupler and production method and use thereof
  • Transferrin-frog-egg ribonuclease coupler and production method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0082] Preparation method of the conjugate

[0083] The inventor finds in research, adopts SPDP alone to prepare transferrin-frog egg ribonuclease conjugate as a coupling agent, the conjugate obtained is random, has different structures, and has a large difference in molecular weight. It is beneficial for purification, and the proportion of conjugates entering tumor cells is low.

[0084] The present inventor has carried out long-term research and improvement, has found a kind of method that can prepare transferrin-frog egg ribonuclease conjugate that meets the requirements, and described method comprises:

[0085] (1) utilizing N-hydroxysuccinimide 3-(2-pyridyldithio)propionate (SPDP) and 2-Iminothiolane HCl to couple transferrin and frog egg ribonuclease; and

[0086] (2) Separating and obtaining the transferrin-frog egg ribonuclease conjugate.

[0087] As a preferred mode of the present invention, the method includes:

[0088] (a) Contact transferrin with N-hydroxysuccin...

Embodiment 1

[0108] Embodiment 1 Onc protein preparation

[0109] 1. Construction of expression Onc plasmid

[0110] According to the sequence shown in SEQ ID NO: 3, the coding sequence of Onc protein was synthesized from the whole sequence, and the primers at both ends were designed as follows:

[0111] The 5' primer is: CCCAGGACTGGCTGACTTTCCA (SEQ ID NO: 5);

[0112] The 3' primer is: AAAGTCGACTCAGCAAGAACCAACACC (SEQ ID NO: 6);

[0113] Using the previously synthesized gene sequence as a template and using SEQ ID NO: 5 and SEQ ID NO: 6 as primers, PCR amplification was carried out, and the amplified product was cloned into the MscI and Between the SalI sites, an expression plasmid capable of expressing Onc was obtained.

[0114] 2. Onc protein expression

[0115] The previously constructed expression plasmid was transformed into Escherichia coli BL21(DE3), and a single clone was picked overnight in 50 ml LB medium and cultured overnight at 37°C. The next day, transfer 1 LTB medium a...

Embodiment 2

[0127] Example 2 Preparation of transferrin Tf and ribonuclease Onc conjugate

[0128] A. Coupling with SPDP and 2-Iminothiolane

[0129] 1. Tf (purchased from CALBIOCHEM, batch number is Cat: 616397, powder, its amino acid sequence such as SEQ ID NO: 2) is dissolved in PBS (pH7.4) to make the final concentration 20mg / ml, add 50 μ l (equivalent to According to the molar ratio of about 10 times of Tf) 50mM SPDP, mixed quickly, reacted for 30min, separated with desalting column HiTrap Desalting (5×5ml, Pharmacia), mobile phase was PBS (pH7.4), collected step by step , 10% SDS-PAGE test results, set aside egg samples for future use.

[0130] 2. Dissolve the previously prepared and purified Onc protein in 20mM phosphate buffer (pH6.0) so that the final concentration is 1mg / ml, add 16.67μl of 50mM 2-Iminothiolane HCl (Promega, equivalent to about 10 times the amount of Onc), mixed quickly, and after 1 hour of reaction, dialyzed to remove small molecules.

[0131] 3. Mix Onc and Tf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a transferrin-frogspawn ribalgilase conjugate which belongs to the biological medicine field. The conjugate includes one transferrin and 1-5 frogspawn ribalgilase. The invention also discloses a method for preparing the conjugate, an use and a pharmaceutical composition containing the conjugate. Many tumour cells high express transferrin receptor, and transferrin is easy to be endocytosis after combining with the receptor, accordingly the conjugate is easy to enter into cytolymph than dissociative frogspawn ribalgilase and has stronger and special ability for killing tumour cell.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and more specifically, the invention relates to a transferrin (Tf)-frog egg ribonuclease (Onconase) conjugate and a preparation method and application thereof. Background technique [0002] Frog egg ribonuclease (Onconase, also known as: P30protein, Ranpirnase, Onc for short) is a nuclease isolated from leopard frog (Rana pipiens) oocytes and early embryos, belonging to the RNaseA superfamily. Studies have shown that Onc enters cells through endocytosis, selectively degrades tRNA in the cytoplasm, inhibits protein synthesis, thereby inhibiting cell proliferation and causing cell apoptosis. In vitro experiments have shown that Onc has anti-proliferation and cytotoxic effects on a variety of tumor cells, such as: human prostate cancer cells, pancreatic cancer cells, and leukemia cells. In vivo experiments in mouse models have proved that Onc can inhibit tumor growth, prolong the survival time of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/48A61K38/46A61P35/00A61K47/64
Inventor 王庆诚沈如凌许国峰孙瑞林费俭王铸钢
Owner SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com