India glossy ganoderma 128 bacterial strain or fruiting body specific molecular marker and obtainment method and application

Abstract

The invention relates to an India glossy ganoderma 128 bacterial strain or fruiting body specific molecular marker and an obtainment method and application thereof. The marker is the specific DNA fragment of 465bp after the amplification of PCR and the PCR amplifier pair sequence is 5'cttcagatcgtaaaacgggt 3' and 5' gtcataaagttgtctccaac 3'; and the obtainment method includes: 1) the extraction of bacterial strain or fruiting body genomic DNA; 2) the obtainment of specific DNA fragment; 3) the obtainment of specific PCR amplifier; 4) the use of specific PCR amplifier pair to amplify the bacterial strain or fruiting body genomic DNA; and 5) agarose gel electrophoresis detection. The application includes: being used for rapidly identifying and detecting the truth of India glossy ganoderma 128 bacterial strain and commercially available glossy ganoderma products. Compared with regular morphologic detection, experiments of antagonism and fruiting tests, the obtainment method has the advantages of short detection time and high accuracy.

Description

technical field [0001] The invention belongs to the field of identification of ganoderma lucidum strains, and in particular relates to an Indian ganoderma lucidum 128 strain or a specific molecular marker for fruiting body and its obtaining method and application. Background technique [0002] According to "Shen Nong's Materia Medica" and "Compendium of Materia Medica", Ganoderma lucidum is beneficial to the heart, nourishes the heart and generates blood, helps the heart to fill the pulse, calms the nerves, nourishes the spleen and lungs, strengthens the muscles and bones, sharpens the joints, and cures deafness. Modern studies have found that Ganoderma lucidum not only has curative effects on cancer, cerebral hemorrhage, and heart disease, which are the three major causes of death in humans, but also has significant curative effects on diseases such as gastrointestinal, liver, kidney, leukemia, neurasthenia, chronic bronchitis, asthma, and allergies. In addition, Ganoderma ...

AI Technical Summary

Problems solved by technology

In recent years, with the commercialization of various products of Ganoderma lucidum, the rapid development of Ganoderma lucidum cultivation and production in China has been greatly promoted. At the same time, the germplasm resources of Ganoderma lucidum are also expanding. The strains used for the production of Ganoderma lucidum are relatively confusing, and the phenomenon of the same species with different names and different names and the same species is very common in cultivation and production. Related industries have caused certain economic losses

Nowadays, the quality of ganoderma lucidum products in my country is difficult to stabilize due to strain problems, and it also seriously restricts the pace of ganoderma lucidum products going abroad and entering the international market.

[0004] The traditional classification and identification are mainly based on the morphological characteristics of the fruiting body, including the size of the basidiospore and the morphological characteristics of the dermal hyphae of the fruiting body. However, many morphological characteristics of the fruiting body often change with different growth conditions, and many Distinguishing characteristics are often shared by several species, which brings great difficulties to traditional taxonomy. It is not very reliable to identify strains based solely on morphological characteristics

Images