Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof

An oncolytic adenovirus, construction method technology, applied in the construction of three-targeted chimeric oncolytic adenovirus Ad5/F11 vector and its application field, can solve the problems of limited application, lack of CAR, low infection efficiency, etc. Enhanced safety, ensures specific replication, and enhances the effect of lethality

Inactive Publication Date: 2009-10-28
ZHEJIANG SCI-TECH UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the infection efficiency of Ad5 to cells is highly dependent on the expression level of coxsackie virus and adenovirus receptor (CAR) on the cell surface, but nearly 50% of epithelial cell-derived tumor cells lack CAR on the surface, It is even hardly expressed on the surface of hematological tumor cells, which makes the infection efficiency of adenovirus to these tumor cells low, and even has no ability to infect hematological tumors
This feature limits its application in the treatment of epithelial cell-derived tumor cells and hematological tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof
  • Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof
  • Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of tumor-targeted chimeric oncolytic adenoviral vector pCN205-IL-24-11p carrying foreign genes and acquisition of virus AdCN205-11-IL-24

[0040] 1. Construction of the shuttle plasmid p11zf-ad5-ad11p:

[0041] 1. SacI, EcoR I double-digested the 3602 plasmid, recovered a 1706bp band, and named it L1; SacI, EcoR I double-digested the pGEM-11ZF(+) plasmid, and named it J1.

[0042] 2. Connect L1 and J1 to obtain a 4925bp plasmid, named J2.

[0043] 3. PCR 3602 plasmid (32788-33105), named L2. The primers are Primer L2up: 5>aactcccccttaaggcatgcactagggcccagaatcgtttgtgt<3.

[0044] 4. Double digestion of J2 plasmid with Apa I and Sph I to obtain J3; double digestion of L2 fragment with Apa I and Sph I to obtain L2-1.

[0045] 5. Ligate J3 and L2-1 to obtain plasmid J4 (5233bp).

[0046] 6. Hind III, Af1 II double digested 3602, and recovered 1826bp fragment L3; Hind III, Af1 II double digested J4 to obtain J5, and ligated with L3 to obtain J6.

...

Embodiment 2

[0067] Example 2: Virus infection efficiency experiments on CD46+ tumor cells and normal blood cells

[0068] According to the cell growth rate determined in the preliminary test, myeloid leukemia cell lines K562 and Kasumi-1 in the logarithmic growth phase, T-lineage leukemia cell line 6T-CEM and peripheral blood lymphocytes (normal cells) PBMC were mixed at a rate of 5×105 / The wells were implanted into 6-well culture plates, and cultured in a 5% CO2 incubator at 37°C for 6 hours. The above cells were divided into two groups, infected with non-replicating adenoviruses Ad5-EGFP, Ad11-EGFP and replicating adenoviruses AdCN205-EGFP, AdCN205-11-EGFP respectively, and cultured in a 5% CO2 incubator at 37°C for 24 hours. The above cells were collected, washed twice with PBS containing 2% FBS, resuspended in 500 μl of PBS containing 2% FBS, and the positive rate of EGFP was detected by flow cytometry. The above experiments were respectively infected with viruses at three concentra...

Embodiment 3

[0070] Example 3: Detection of the killing ability of virus AdCN205-11-IL-24 to normal cells and tumor cells in vitro

[0071]Myeloid leukemia cell lines K562 and Kasumi-1 in the logarithmic growth phase, cervical cancer cell line Hela, lung cancer cell line H460 and colon cancer cell line Sw620 were inoculated into 96-well plates at the amount of 1×104 / well; The T-lineage leukemia cell line 6T-CEM and peripheral blood lymphocytes (normal cells) PBMC in the growth phase were inoculated into 96-well plates at an amount of 2×104 / well, and after 24 hours of culture, 10 MOI of virus was added to each well, and cells without virus were added. As a control, the samples without virus and cells were used as zero-adjustment wells, and 6 replicate wells were made for each. Continue culturing in a 5% CO2 incubator at 37°C. After 24, 48, 72, 96, and 120 hours of virus-infected cells, 20 μl of MTT solution (5 mg / ml) was added to each well, and after culturing at 37°C for 4 hours, triple s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of three-target mosaic type oncolytic adenovirus Ad5 / F11 carrier and use thereof, wherein the carrier uses a double-target oncolytic adenovirus carrier pCN103 and Pcn205 as the basis and the frame of 5 type adenovirus Ad5 is chimeric with the fibrin fiber of human 11 type adenovirus Ad11 and the human telomerase reverse transcriptase hTERT promoter is used for adjusting and controlling the E1A gene deleted with CR2 section and necessary for Rb protein binding and the carrier system is used for controlling the exogenous gene capable of killing and inhibiting various cancers, such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1, cpp-SOCS1 and the vivo and vitro experiment shows that the carrier has good anti-cancer effect. The three-target mosaic type oncolytic adenovirus, such as AdCN205-11-1l-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1 can be used for treating various cancer and developing new virus-gene anti-cancer medicine capable of effectively treating cancer.

Description

technical field [0001] The invention belongs to the field of gene therapy, in particular to a three-target chimeric oncolytic adenoviral vector that utilizes a human adenovirus type 5 (Ad5) backbone to chimerize human adenovirus type 11 (Ad11) fiber (fiber) The construction method and the application of carrying all exogenous genes capable of killing and inhibiting cancer such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and cpp-SOCS1. Background technique [0002] Malignant tumors seriously endanger human health. At present, there is still no effective treatment for the vast majority of patients with advanced tumors. With the rapid development of cell biology and molecular biology theory and technology, gene therapy strategies for tumors emerged as the times require. With the rapid development of virology and oncology, people are trying to use the modified virus for the research of tumor treatment. [0003] The targeted gene-virus therapy strategy for cancer is to use oncolyt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861A61K48/00A61P35/00
Inventor 钱程刘立张磊杨智
Owner ZHEJIANG SCI-TECH UNIV