Polygonatum cyrtonema microsatellite markers

A technology of microsatellite marker and Polygonatum polyflora is applied in the field of microsatellite molecular genetic marker of Polygonatum polyflora, which can solve the problems of poor repeatability, inability to distinguish pure sum genotype and heterozygous genotype, etc.

Inactive Publication Date: 2010-02-24
ANHUI NORMAL UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the stability and repeatability of RAPD molecular markers are poor, and ISSR molecular markers are usually dominant markers, which cannot distinguish pure and heterozygous genotypes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polygonatum cyrtonema microsatellite markers
  • Polygonatum cyrtonema microsatellite markers
  • Polygonatum cyrtonema microsatellite markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Construction of Polygonatum polyflora microsatellite DNA enrichment library

[0030] 1.1 Genome extraction and digestion:

[0031] Using the CTAB method introduced by Doyle J (Doyle J. DNA protocols for plants-CTAB totalDNA isolation [A]. In Hewitt GM, Johnston A (eds.), Molecular Techniques in Taxonomy [M]. Berlin: Springer, 1991, 283-293 ) to extract the genome, digest the genome with the restriction endonuclease Sau3AI (purchased from TaKaRa company), and electrophoresis the digested product on 1% agarose gel, cut out the DNA fragment of 300-900bp size under ultraviolet light and use the gel recovery kit (purchased from Shanghai Sangong) to purify and recover the digested product.

[0032] 1.2 Add connector:

[0033] Add the two ends of the purified and recovered enzyme-cut product to the adapter:

[0034] LA(5'-GGCCAGAGACCCCCAAGCTTCG-3')

[0035] LB(5'-PO 4 -GATCCGAAGCTTGGGGTCTCTGGCC-3'),

[0036] Under the action of T4 ligase (purchased from Promega), the ...

Embodiment 2

[0055] 2.1 Screen polymorphic primers:

[0056] Use the CTAB method of 1.1 to extract the Rhizoma Polygonatum genome. The genome was amplified with designed primers (Table 1). Reaction program: pre-denaturation at 94°C for 4 minutes, denaturation at 94°C for 45 seconds, annealing for 30 seconds (see Table 1 for annealing temperature), extension at 72°C for 35 seconds, and three steps from denaturation to annealing were repeated 35 times. A final full extension at 72°C for 8 minutes. 1.5% agarose gel electrophoresis detection. PCR products were detected by PAGE electrophoresis, and a total of 14 polymorphic microsatellite markers were obtained; Pc1 was 480 nucleotides, Pc2 was 550 nucleotides, Pc3 was 310 nucleotides, and Pc4 was 338 nuclei Pc5 is 630 nucleotides, Pc6 is 767 nucleotides, Pc7 is 435 nucleotides, Pc8 is 584 nucleotides, Pc9 is 399 nucleotides, Pc10 is 595 nucleotides , Pc11 is 677 nucleotides, Pc12 is 512 nucleotides, Pc13 is 488 nucleotides, and Pc14 is 473 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses polygonatum cyrtonema microsatellite markers. A method for realizing the technical scheme of the invention comprises the following steps: constructing an enriched library of apolygonatum cyrtonema microsatellite (CT)n; screening and sequencing positive clones containing microsatellite sequences to obtain 55 clones containing microsatellite repetitive sequences; and screening the 55 clones to obtain the following 14 high-polymorphism microsatellite molecular markers: Pc1, Pc2, Pc3, Pc4, Pc5, Pc6, Pc7, Pc8, Pc9, Pc10, Pc11, Pc12, Pc13 and Pc14. The 14 microsatellite markers can be used for researching the genetic diversity of polygonatum cyrtonema, variable and evolutionary relationships among species and populations of polygonatum plants and the authentication of polygonatum cyrtonema varieties, have the characteristic of good repetitiveness, and are reliable and effective molecular markers.

Description

technical field [0001] The invention relates to molecular marker technology, in particular to a microsatellite molecular genetic marker of Polygonatum polyflora. Background technique [0002] Microsatellite DNA is also called short tandem repeats (Short Tandem Repeats, STRs), simple sequence repeats (Simple Sequence Repeat, SSRs), simple sequence length polymorphism (SSLP). Refers to the nucleotide sequence composed of 1 to 6 nucleotides in series in the genome. According to the composition of repeating units, microsatellite DNA sequences are divided into three types: single type, compound type (compound) and interrupted type (interrupted). For example: [0003] Single type: ATATATATATATATATATATATAT [0004] Composite type: ATATATCACACACACACACACAC [0005] Intermittent type: ATATATCA ATATATCA ATATATA [0006] As a molecular marker, microsatellite DNA has the following characteristics: it is widely distributed in the genome of eukaryotes; the number of repeats of the cor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor朱国萍程文娟刘婷婷彭艳秋王晖王宗达陈露露
OwnerANHUI NORMAL UNIV