Recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion and applications thereof

A vaccinia virus and gene deletion technology, which is applied in antiviral agents, genetic engineering, plant gene improvement, etc., can solve the problems of inability to induce CTL response, inability to protect HIV-1 attack, etc., and achieve the goal of improving safety and immunogenicity Effect

Inactive Publication Date: 2010-03-17
NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies in orangutan models have shown that inactivated vaccines cannot protect against HIV-1 challenge and cannot induce CTL responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion and applications thereof
  • Recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion and applications thereof
  • Recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment one, the construction of transfer plasmid

[0039] 1. Construction of plasmid pBR-SK

[0040] 5'PBR322-SACI-FOR

[0041] G GAGCTC CGACCGATGCCCTTGAGAGCC

[0042] 3'PBR322-KPNI-RE

[0043] GG GGTACC AGGTGGCACTTTTCGGGGAAATG

[0044] PCR amplified commercial plasmid pBR322 including the sequence of all functional elements, denoted as pBR.

[0045] reaction system

[0046] 10×Pyrobest Buffer 5μl

[0047] dNTPMisture (2.5mM each) 5μl

[0048] 3'PBR322-KPNI-RE (50μM) 0.5μl

[0049] 5'PBR322-SACI-FOR (50μM) 0.5μl

[0050] pBR322 0.5 μl

[0051] Pyrobest DNA Polymerase (5U / ml) 0.5μl

[0052] ddH2O 38μl

[0053] Reaction conditions Pre-denaturation at 94°C for 2 minutes; 94°C for 30 s, 68°C for 5 min, a total of 35 cycles; 72°C for 7 min; 4°C.

[0054] The PCR product pBR was purified and co-digested with KpnI and SacI of Dalian Biotech, and recovered by running gel.

[0055] The plasmid pBS-SK was co-digested with KpnI and SacI of Dalian Baobiology to...

Embodiment 3 8

[0108] Example 3 B8R gene deletion expresses HIV-1 antigen VTKgpeΔB8RlacZ (B8R gene deletion is replaced by lacZ, TK region is inserted into B' / C type CN54 strain HIV-1 gagpol env gene) AIDS vaccine of Tiantan strain recombinant vaccinia virus.

[0109] VTKgpe (Tiantan strain recombinant vaccinia virus whose TK region is inserted into the B' / C type CN54 strain HIV-1 gagpol env gene) and the transfer plasmid pSKB8RLacZ were co-transfected into CEF cells for homologous recombination. After blue-white screening, continuous single-spot purification, The recombinant virus VTKgpeΔB8RlacZ with the deletion of B8R gene replaced by lacZ was identified. After infecting 80% of CEF cells in a sheet with 0.1-0.01 PFU / cell virus amount VTKgpe and adsorbing for 1-1.5 hours, the recombinant plasmid pSKB8RLacZ was transfected into CEF cells using liposome transfection technology (refer to the Lipofectin kit from INVITROGEN, USA). After 48 hours, the recombinant virus liquid was harvested, and ...

Embodiment 4

[0110] Example 4 AIDS vaccine of Tiantan strain recombinant vaccinia virus with B8R gene deletion and HIV-1 antigen-expressing VTKgpeΔB8R (B8R gene deletion without lacZ selection marker, TK region inserted into B' / C type CN54 strain HIV-1 gagpol env gene) .

[0111] Then, VTKgpeΔB8RlacZ was used as the parent strain to co-transfect CEF cells with pSKB8RNeo for homologous recombination. After G418 pressure screening, blue-white screening, continuous single-spot purification, and identification of the recombinant virus VTKgpeΔB8R with B8R gene deletion and no lacZ selection marker. After infecting 80% of CEF cells in a sheet with 0.1-0.01 PFU / cell virus amount VTKgpeΔB8RlacZ for 1-1.5 hours, the recombinant plasmid pSKB8RNeo was transfected into CEF cells using liposome transfection technology (refer to the Lipofectin kit from INVITROGEN, USA). After 48 hours, the recombinant virus fluid was harvested, and pressure-transferred with 400ug / ml G418 for three generations. Use nutr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an attenuated carrier of recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion, and AIDS vaccines of recombinant vaccinia virus of Tiantan strain with IFN-gamma receptor gene (B8R) deletion used for expressing various antigens (univalent or polyvalent) of HIV-1 and constructed based on same, a recombinant vaccinia virius VTKgpe recombinant vacciniavirus VTKgpe CGMCC.NO.1099 and another hepatitis B virus HBSAg antigen, and hepatitis B virus vaccines of recombinant vaccinia virus of Tiantan strain of IL-2. The invention has an importantmeaning to the use for preparation of recombinant vaccinia virus vaccines for treating virus diseases.

Description

technical field [0001] The present invention relates to the Tiantan strain recombinant vaccinia virus attenuated vector with deletion of IFN-γ receptor gene (B8R) and the IFN-γ receptor gene (B8R) expressing HIV-1 various antigens (monovalent and multivalent) constructed on the basis of the carrier. ) deleted Tiantan strain recombinant vaccinia virus AIDS vaccine. The Tiantan strain recombinant vaccinia virus attenuated vector of the present invention can significantly reduce the virulence of the vaccinia virus vector, and can be used to construct a multivalent recombinant vaccinia virus expressing multiple antigens of the same pathogen or different pathogens. The recombinant vaccinia virus AIDS vaccine of the invention can induce high-level humoral and cellular immune responses against human immunodeficiency virus (Human Immunodeficiency Virus, HIV), and effectively improve the safety and immunogenicity of the recombinant vaccinia virus AIDS vaccine. Background technique ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/863A61K39/285A61K39/21A61K39/29A61P31/20A61P31/18C12R1/93
Inventor 邵一鸣黄薇刘颖
Owner NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap