Noble cell of human embryonic stem cell for stably expressing HLA-G molecules

A human embryonic stem cell, HLA-G technology, applied in cells modified by introducing foreign genetic material, biochemical equipment and methods, material testing products, etc., can solve problems such as immune rejection, and achieve small immune response and far-reaching clinical application. effect of value

Inactive Publication Date: 2010-06-23
赵宏喜 +3
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The technical problem to be solved by the present invention is to provide a human embryonic stem cell differentiated cell capable of stably expressing HLA-G molecules, so as to solve the major problem of immune rejection faced by human embryonic stem cell differentiated cells during transplantation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Expression of HLA-G protein in human embryonic stem cells

[0039] 1. Expression of HLA-G protein in human embryonic stem cells

[0040] (1) Western-blot detection of HLA-G protein expression in human embryonic stem cells

[0041] MEM-G / 1 monoclonal antibody (Serotec Company) 1:500 was used to detect the expression of HLA-G protein in human embryonic stem cells. For specific steps, see "Molecular Cloning Third Edition"

[0042] (2) Detection of HLA-G protein expression in human embryonic stem cells by immunofluorescence

[0043] Human embryonic stem cells were co-stained with Oct-4 monoclonal antibody (Chemicon) (1:100) and MEM-G / 9 monoclonal antibody (1:25), and the expression of HLA-G protein in human embryonic stem cells was examined. For specific steps, see "Molecular Cloning Third Edition"

[0044] Results: Human embryonic stem cells do not express HLA-G protein

Embodiment 2

[0045] Example 2: Inducing random differentiation and directed differentiation of human embryonic stem cells into dopaminergic neurons and pancreatic cells and examining the expression of HLA-G molecules

[0046] 1. Random differentiation of human embryonic stem cells and expression of HLA-G molecules

[0047] Human embryonic stem cells were digested with trypsin, planted in a culture dish without a feeder layer and covered with matrigiel, and the bFGF factor in the culture medium was removed to make it randomly differentiate. The cells were collected at 1 week, 2 weeks, 3 weeks, and 4 weeks, proteins were extracted, and the expression of HLA-G molecules in these differentiated cells was detected by Western-blot. The results showed that the differentiated cells of human embryonic stem cells did not express HLA-G protein.

[0048] 2. Human embryonic stem cells were induced to differentiate into dopaminergic neurons and the expression of HLA-G molecules was detected

[0049] H...

Embodiment 3

[0054] Example 3: Preparation of human embryonic stem cell differentiated cells stably expressing HLA-G molecules

[0055] 1. Construction of HLA-G lentiviral eukaryotic expression vector

[0056] (1) Obtain cDNA of placental tissue;

[0057] (2) Design primers, the primer sequence is: the upstream primer sequence is as described in SEQ ID No.1, namely: ATCGTCTAGAATGGTGGTCATGG; the downstream primer sequence is as described in SEQ ID No.2, namely: ATCGTGTACATCACTTGTCATCGTCGTCCTTGTAGTCATCTGAGCTCT. Use the designed primers for PCR amplification to obtain the full-length sequence of HLA-G1 and recover it;

[0058] (3) Connect it to the T-easy plasmid, digest (upstream XbaI endonuclease, downstream BsrGI endonuclease), sequence identification, and the measured sequence is as described in SEQ ID No.3.

[0059] (4) Ligate the full length of HLA-G to the lentiviral plasmid.

[0060] (5) Packaging the lentivirus in 293T cells to construct the eukaryotic expression vector of HLA-G. Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a noble cell of a human embryonic stem cell for stably expressing HLA-G molecules. Rich cell resources are provided for clinical cellular transplantation, the problem of immunological rejection during the transplantation of the directional noble cell of the human embryonic stem cell in the clinic is solved, and the invention has the profound clinical application value.

Description

technical field [0001] The invention relates to a human embryonic stem cell differentiation cell stably expressing HLA-G molecules. Background technique [0002] Human embryonic stem cells have the characteristics of self-replication and multipotential differentiation, and can theoretically differentiate into any cell in the body, such as cardiomyocytes, pancreatic β cells, dopaminergic neurons, etc., providing a rich source of cells for clinical cell transplantation. However, human embryonic stem cell-differentiated cells face a major problem of immune rejection during transplantation. HLA-G belongs to the non-classical HLA-I gene (HLA-Ib), and there are 7 subtypes, 4 of which are membrane-bound (HLA-G1, G2, G3, G4) and 3 soluble types (HLA- G5, G6, G7), mainly distributed in extravillous cytotrophoblasts at the maternal-fetal interface, and play an important role in maternal-fetal immune tolerance and organ transplantation. Contents of the invention [0003] The techni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/12C12N15/867G01N33/68
Inventor赵宏喜姚元庆李凌松王莉
Owner赵宏喜