Methods for detecting and modulating the sensitivity of tumour cells to anti-mitotic agents

A tumor cell, sensitive technology, applied in the direction of biochemical equipment and methods, medical preparations containing active ingredients, antineoplastic drugs, etc., can solve the problem that the efficacy of βIII tubulin has not yet been determined

Inactive Publication Date: 2010-07-14
NEWSOUTH INNOVATIONS PTY LTD
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Furthermore, although DNA damaging agents are commonly used in combination therapy with vinca alkaloids, the effect of βIII tubulin expression on the efficacy of these agents has not been established

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for detecting and modulating the sensitivity of tumour cells to anti-mitotic agents
  • Methods for detecting and modulating the sensitivity of tumour cells to anti-mitotic agents
  • Methods for detecting and modulating the sensitivity of tumour cells to anti-mitotic agents

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0175] Example 1. Cell culture and siRNA transfection

[0176] Human NSCLC cell lines Calu-6 and H460 (ATCC: Calu6 Cat. No. HTB-56, NCI-H460 Cat. No. HTB-177) were maintained as monolayer cultures in Dulbecco's Modified Eagle Medium (DMEM) and RPMI, respectively, The medium was supplemented with 10% fetal calf serum (FCS) and 2 mM L-glutamine. Cells at 37°C with 5% CO 2 grow in a moist atmosphere.

[0177] Various siRNAs or shRNAs were used in the Examples described herein.

[0178] class III beta-tubulin

[0179] (formal code: TUBB3), also known as MCIR; TUBB4; β-4SMARTpool, human TUBB4, NM_006086 (class III β-tubulin) Dharmacon RNA Technologies

[0180] class III beta-tubulin sequence 1

[0181] Sense sequence: GGGCGGAGCUGGUGGAUUCUU (SEQ ID NO: 1)

[0182] (bits 327 to 245, mismatches at bits 346 to 347)

[0183] Antisense sequence: 5Phos-GAAUCCACCAGCUCCGCCCUU (SEQ ID NO: 2)

[0184] class III beta-tubulin sequence 2

[0185] Sense sequence: GUACGUGCCUCGAGCCAUUUU (S...

Embodiment 2

[0244] Example 2: Analysis of β-tubulin isoforms

[0245] The effect of siRNA transcription on the expression of β-tubulin isoforms was assessed using reverse transcription-PCR (RT-PCR) analysis of β-tubulin isoforms and by Western blotting. For reverse transcription analysis, total RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA samples were treated with DNase and reverse-transcribed for RT-PCR analysis using the method and specific primers described in Kavallaris et al. (1997) J ClinInvest 100, 1282-1293, the entire contents of which are incorporated herein by reference. For the Hβ9 (class II), H5β (class IVa), and Hβ2 (class IVb) genes, semiquantitative PCR-based testing involves setting up two separate PCR tubes for the target (beta tubulin) and control (beta 2 Microglobulin) gene sequence. Amplification products were resolved on a 12.5% ​​polyacrylamide gel and visualized by ethidium bromide staining with a GelDoc 100...

Embodiment 3

[0248] Example 3: Drug-resistant clone testing

[0249] Cells were transfected for 24h and approximately 600 cells (for Calu-6) or 150 cells (for H460) were seeded into each well of a 6-well plate and allowed to attach for 4-6h. The cell lines used in this study did not undergo prior drug selection and tended to exhibit the intrinsic drug resistance observed in lung cancer.

[0250] Cells were then treated with increasing concentrations of various anti-mitotic drugs. After 3 days of incubation at 37°C, the drug-containing medium was removed and replaced with fresh complete medium. The medium was changed every 3 to 4 days for 7 to 10 days until visible colonies were formed. Control cells were treated identically with similar media changes. Surviving colonies were simultaneously fixed and stained with 0.5% crystal violet in methanol, washed with water to remove excess staining and air dried overnight.

[0251] The colonies in each well were manually counted, and the results ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method of screening a tumour cell for resistance to a tubulin-binding agent, the method comprising detecting the expression of any one or more of class II, class III and class IVb ss-tubulin by the tumour cell, wherein the expression of any one or more of class II, class III and class IVb ss-tubulin indicates that the tumour cell has resistance or potential resistance to the tubulin-binding agent.

Description

[0001] related application [0002] This application claims priority to Australian Provisional Patent Application No. 2007901131, filed 5 March 2007, and Australian Provisional Patent Application No. 2007905307, filed 28 September 2007. Each application is incorporated herein by cross-reference in its entirety. technical field [0003] The present invention relates to a method for screening tumors for sensitivity to anti-mitotic agents based on the expression characteristics of tumors to β-tubulin, and to methods for regulating β-tubulin in tumor cells, especially class II, III or IVb β-tubulin Method for expression of tubulin. The present invention also relates to molecules and methods for enhancing the sensitivity of tumor cells to tubulin binding agents such as vinca alkaloids, taxanes and epoxypolytubulin, and to other anticancer agents. Background technique [0004] Microtubules are required for cell division in eukaryotic cells and serve as part of the spindle that e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/7088G01N33/483
CPCG01N33/57496G01N2800/56A61K31/165A61K31/7088C12N15/113A61K45/06G01N33/5044C12N2310/14C12N2310/53G01N33/5011A61K48/00G01N2800/52C12N2310/111G01N2800/44A61P35/00A61P43/00A61K2300/00C12N2320/30C12Q1/6886C12Q2600/158
Inventor玛丽亚·卡瓦拉里斯颜佩佩
OwnerNEWSOUTH INNOVATIONS PTY LTD