Fusogenic polypeptide for inhibiting neovascularization and coding gene and application thereof
A technique of fusing polypeptides and coding genes, which is applied in the field of diseases and can solve problems such as the complexity of the inhibitory mechanism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1, expression of fusion polypeptide MEK
[0031] 1. Design of fusion polypeptide (protein)
[0032] A decapeptide that inhibits metal matrix protease (MMP2 or MMP9), the first 25 peptides of endostatin and the k5 sequence of angiostatin are linked together in order of decapeptide-25 peptide-K5 to form a fusion sequence of MEK, such as SEQID in the sequence listing As shown in No.2, where: the first 10 amino acid residues (CTTHWGFTLC) are composed of an active small peptide that inhibits metal matrix protease MMP2 / 9; the next 25 amino acid residues are composed of the first 25 peptides of endostatin ; The following 9 amino acid residues (ERETPSEED) are the connecting peptide sequence; the last 81 amino acid residues form the k5 domain of angiostatin.
[0033] 2. Construction of Fusion Polypeptide Expression Vector
[0034] Design the following primers:
[0035] Primer 1: 5'- CTCGAG AAAAGATGTACAACTCACTGGGGTTTCACACTTTGCCACAGC C ACCGCGACTTC-3' (the underlin...
Embodiment 2
[0045] Embodiment 2, the test of MEK to cell proliferation inhibition
[0046] HUVEC is a kind of vascular endothelial cell, which is recognized as a research material for inhibiting angiogenesis. Materials used in this experiment: endothelial cell line (HUVEC) was isolated from the umbilical cord of newborns, within 10 passages, donated by the Cancer Institute of Peking University Hospital; MTT was purchased from sigma company; cell culture medium was from GIBCO company; calf serum was from GIBCO company
[0047] Methods: HUVEC endothelial cells were cultured in M199, 20% FBS medium. The cultured cells were divided into 1.2×10 5 Each was equally transferred to a 12-well cell plate, cultured with 1ml of medium per well for two days, and added with different concentrations of k5, RK5, and MEK (concentrations were 0.125 μg / ml, 0.25 μg / ml, 0.75 μg / ml, 1.5 μg / ml, respectively). ml), after 72 hours of treatment, 50ml of MTT (5μg / ml) was added to each well for 4 hours. Then the m...
Embodiment 3
[0049] Embodiment 3, MEK is to the test of cell metastasis inhibition
[0050] Materials: Endothelial cell line (HUVEC) was isolated from neonatal umbilical cord, 24-well suspended Transwell migration chamber was purchased from Millipore Company, matrigel was purchased from BD Company, crystal violet was purchased from Merk Company, and bFGF and VEGF were purchased from Sigma Company.
[0051] Method: After matrigel was melted at 4°C, it was diluted with serum-free M199 at a volume ratio of 1:3 (matrigel:serum-free M199), and 50 μg of diluted matrigel was added to the upper chamber. After solidification overnight, the upper chamber was inoculated with 2 × 10 M199 in 3% FBS. 5 Add 20% FBS-containing M199, 60ng / ml VEGF, 60ng / ml bFGF to the lower chamber, and add protein to the lower chamber. Within 72 hours of migration, fix with 4% formaldehyde for 20 minutes, and dissolve 0.1 % crystal violet staining, after fully washing with PBS, take pictures or statistics.
[0052] Test ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More