Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing humanized monoclonal antibody using animal mammary gland bioreactor

A monoclonal antibody and antibody technology, applied in biochemical equipment and methods, botanical equipment and methods, cells modified by introducing foreign genetic material, etc., can solve problems such as expensive production cost, limited output, and complicated purification process, etc. Achieve low cost, high yield, significant economic and social value

Inactive Publication Date: 2010-11-17
BEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most commercial antibodies are expressed by mammalian cell lines, but the production of antibodies expressed by cells is limited (0.1-1 g / L), and large-scale production will inevitably bring expensive production costs
In addition, the purification process in the later stage is complicated, and the expression level and activity of different batches of produced antibodies may be different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing humanized monoclonal antibody using animal mammary gland bioreactor
  • Method for producing humanized monoclonal antibody using animal mammary gland bioreactor
  • Method for producing humanized monoclonal antibody using animal mammary gland bioreactor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Transgenic cells expressing human monoclonal antibodies

[0025] 1) Construction of human antibody mammary gland expression vector

[0026] According to the human immunoglobulin G1 light chain constant region sequence (GenBank number: AH002839S3) on GenBank, primers were designed and introduced into the BglII site in the upstream primer and the SalI site in the downstream primer (upstream primer LCF: 5'-CAGATCTAACTTAATTAAGGAATAGG-3 ', the downstream primer LCR: 5'-TGTCGACCTCTAACACTCTCCCCTGTT-3'), the human genome was used as a template for PCR amplification, after the amplified product was sequenced and verified to be correct, it was digested with BglII and SalI, and the digested product was recovered and connected to the same The modified pGEM-5Zf vector digested with BglII and SalI (the NdeI site of the pGEM-5Zf vector is introduced into a linker containing the BglII site, and the linker sequence is GTCATATGTTCCAGATCTCAGACATATGGT) to construct a pGEM-LC vec...

Embodiment 2

[0045] Example 2. Preparation of transgenic livestock expressing human monoclonal antibodies

[0046] 1) Preparation of transgenic cattle expressing human monoclonal antibodies

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing a humanized monoclonal antibody using an animal mammary gland bioreactor. The method comprises the following steps: leading an antibody heavy chain coding gene with a homing sequence at a 5'terminal and an antibody light chain coding gene with a homing sequence at the 5' terminal into a mammal somatic cell to obtain a transgenic cell for antibody expression; taking the transgenic cell as a nuclear transfer donor cell and an oocyte as a nuclear transfer recipient cell, and acquiring a cloned embryo by a nuclear transfer technology; and finally shifting the cloned embryo into livestock uterus for pregnancy by a non-operative method to obtain transgenic livestock, and then producing the monoclonal antibody by the transgenic livestock. In the method, the nucleotide sequence of the homing sequence is sequence 1 in a sequence table. The method for producing the humanized monoclonal antibody using the animal mammary gland bioreactor of the invention has low cost, high antibody yield and important economic and social values.

Description

technical field [0001] The invention relates to a method for producing a humanized monoclonal antibody using an animal mammary gland bioreactor. Background technique [0002] Since the advent of B lymphocyte hybridoma cell fusion technology in 1975, after more than 30 years of development, monoclonal antibodies, as a class of drugs for clinical prevention and treatment, have shown increasingly important roles in medical treatment. At the same time, the fast-growing therapeutic antibody market is also driving a wide range of applications of monoclonal antibodies. In 2002, the global sales of monoclonal antibody drugs reached 5.4 billion US dollars, in 2004 it reached 10.3 billion US dollars, and it is estimated that by 2010 it will reach 30.3 billion US dollars, which will account for 32% of the profits of the biotechnology industry. At present, most commercialized antibodies are expressed by mammalian cell lines, but the production of antibodies expressed by cells is limite...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/13C12N5/10C12N15/06A01K67/027C07K16/10C07K16/04
Inventor 张然汤波李宁
Owner BEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products