Method for regulating plant photoperiod by combining soybean gibberellin with protein gene
A technology of transgenic plants and plants, applied in the fields of botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problems affecting the yield potential and achieve the effect of increasing the distance between stems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1: the cultivation of transgenic GMGBP plant
[0025] 1. Construction of plant expression vector pBI121-GMGBP
[0026] The total RNA of soybean (Glycine max) (Northeast Agricultural University Soybean Science Research Institute) was extracted with Trizol reagent, and the first strand of cDNA was synthesized by reverse transcription as a template, with a sense primer: CG TCTAGA CACAGAATCATGGCCACTCT (the underlined part is the Xba I restriction site), antisense primer: GC GAGCTC CTAATGCCCCTTTTCAAATC (the underlined part is the Sac I restriction site), perform PCR reaction, the PCR condition is 94°C for 5min; 35 cycles: 94°C for 30s, 60°C for 30s, 72°C for 2.5min; 72°C for 5min. The PCR product was detected by electrophoresis on 0.8% agarose gel, and the result showed that the PCR product was 1.8kb. After sequencing, the PCR product has the 74-1921 nucleotide sequence of sequence 1 in the sequence listing. The ORF of sequence 1 in the sequence listing is 83...
Embodiment 2
[0034] Example 2: Functional Analysis of Transgenic GMGBP Tobacco T2 Generation
[0035] 1. Phenotype observation of transgenic tobacco
[0036] The seeds of the T2 generation transformed GMGBP tobacco obtained from Example 1 were sterilized and sowed on MS medium, 16h light / 8h dark (long daylight), and grown at 25°C for 1 month to obtain 30 T2 generation transformed GMGBP tobacco 4 The 4-week-old seedlings of 30 wild-type tobacco plants were obtained by the same method as controls, and the 4-week-old seedlings (GMGBP4) of the fourth plant (GMGBP4) and the 4-week-old seedlings of the 15th plant (GMGBP15) of the T2 generation transgenic GMGBP tobacco were compared with wild-type tobacco plants. Type tobacco 4-week-old seedlings (wild type) to take pictures (such as figure 2 shown), from figure 2 It can be seen that compared with the wild type, GMGBP4 and GMGBP15 have shorter roots, smaller leaves, and larger internode spacing.
[0037]Then 20 4-week-old seedlings of T2 tra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
