Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Protein trimerization modif and application thereof

A protein and trimer technology, which is applied in the field of trimer protein genetic engineering, can solve the problems of narrow application range, low proportion of trimer products, weak aggregation ability of trimerization modules, etc., and achieve the effect of great economic benefits

Active Publication Date: 2012-06-27
HARBIN MEDICAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved by the present invention is to overcome the disadvantages of weak trimerization moiety polymerization ability, low trimer product ratio and narrow application range in the existing trimer protein preparation technology, and provide a high-polymerization, Widely applicable protein trimerization motif, the protein product prepared by using this protein trimerization motif has a large proportion of trimers and high purity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein trimerization modif and application thereof
  • Protein trimerization modif and application thereof
  • Protein trimerization modif and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Construction of fusion recombinant HA1-MTI of influenza virus hemagglutinin protein (hemagglutinin, HA) HA1 subunit and MTI

[0035] 1. Obtain the HA1 gene: first extract the total RNA of influenza virus A / Hong Kong / 8 / 68 (ATCC, USA), and use the obtained total RNA as a template to perform RT reaction to generate cDNA; ) and HA1DOWN (TCTAGCTAGCAGTTTGTTTCTCTGGTACATTTCGC) to amplify the HA1 gene by PCR. The reaction conditions were 98°C for 15s, 60°C for 10s, and 72°C for 2min for a total of 30 cycles. The DNA polymerase was PrimeStar HS DNA Polymerase (TaKaRa, Japan).

[0036] 2. Construction of the HA1-MTI fusion recombinant: the gene encoding the MTI protein (GGAGGTTCTGGAGGGATTAAAGAGGAGATTGCCAAAATCAAAGAAGAAATAGCTAAGATCAAAGAGAAGATAGCTGAGATTGAAAAGAGAATCGCAGAAATTGAAAAGAGAATTGCTGGCGGTTGTTGC) (SEQ ID NO: 1) was synthesized in the multiple cloning site of the vector pcDNA3.1 (+) (InvitrogenE, USA) The carrier pcMTI was obtained, and the purified HA1 gene was cloned into th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein trimerization modif and application thereof. The amino acid sequence of the trimerization modif is shown as SEQ ID NO:1. The protein trimerization modif of the invention is designed according to sequence features of a natural trimer coiled coil, so that the sequence is more optimized. In the process of designing the protein trimerization modif, the tendency that each amino acid forms an oligomer is taken into full consideration, so that the amino acids which are likely to have the capacity of dimerization, tetramerization and the like are excluded and the purity of trimerization components of a product is improved. The protein trimerization modif of the invention can be widely used for researching the structure and the function of a protein of which the native conformation is a trimer, and can be used for expressing the protein which exists in a trimer form naturally in vitro so as to be used for screening ligand molecules which interact with a targetprotein in the trimer form. The protein trimerization modif of the invention can be used for constructing and expressing virus surface antigens which exist in the trimer form naturally, and constructing a candidate gene vaccine or a subunit vaccine.

Description

technical field [0001] The invention relates to a protein trimerization pattern, and also relates to the application of the protein trimerization pattern in preparing or expressing a trimer protein, which belongs to the field of trimer protein genetic engineering. Background technique [0002] Coiled helix is ​​a general term for a class of parallel or antiparallel left-handed superhelical structures formed by two or more right-handed α-helices intertwined. A characteristic of a coiled-coil is that each turn of the helix requires 3.5 amino acid residues, and every two turns form a cycle, thus forming a repeat sequence of multiple heptapeptide units or called a heptad repeat sequence (abcdefg)n. The most common natural coiled-coil is generally composed of 2-5 seven repeat sequences (Vinson C, Myakishev M, Acharya A, et al. Classification of Human B-ZIP Proteins Based on Dimerization Properties. Mol Cell Biol. 2002.22 (18): 6321 -6335). [0003] Amino acids at various positi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C07K19/00C07K14/005
Inventor 凌虹王甲业李妍钟国才周海舟
Owner HARBIN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com