Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression system for nonintegrated, long-time and erasable expression vector

A technology of expression vector and expression system, applied in the field of genetic engineering, can solve the problem that the deletion of foreign gene expression vector cannot be artificially controlled, and achieve the effect of long-term stable expression

Active Publication Date: 2011-01-26
INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

More importantly, none of these methods can artificially control the deletion of foreign gene expression vectors, so there is a great risk in biomedical engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression system for nonintegrated, long-time and erasable expression vector
  • Expression system for nonintegrated, long-time and erasable expression vector
  • Expression system for nonintegrated, long-time and erasable expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The construction of embodiment 1 expression vector

[0050] Construction of pBR322-rrs-Orip-rrs-EBNA1-MCS:

[0051] 1) Synthesize primers with recombinase recognition sequences to obtain rrs-OriP-rrs (primer sequence: P5': GAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATTCCT; P3': AAGCTTATAACTTCGTATAGCATACATTATACGAAGTTATGCAG) from the pCEP4 vector (purchased from Invitrogen) by PCR, and introduce the enzyme at both ends Cutting sites EcoRI and HindIII, digested and inserted into PBR322 to obtain PBR322-rrs-OriP-rrs. 2) PCR amplified EBNA1 from the pCEP4 vector (primer sequence: P5': CGAGCTAGCATGTCTGACGAGGGGCCAGGTACAGG; P3': GGATCCTCTAGAAGATCTCTCGAGTCACTCCTGCCCTTCC), and introduced NheI at the 5' end and XhoI-BglII-XbaI-BamHI (hereinafter referred to as MCS) at the 3' end , Digested with NheI and BamHI and inserted into PBR322-rrs-OriP-rrs to obtain PBR322-rrs-OriP-rrs-(p)EBNA1-MCS. 3) PCR amplified IRES-neo (primer sequence: P5': GAATTCAGCTCGCTGATCAGCCCCCTCT; P3': TCTAGAGGATC...

Embodiment 2

[0053] The construction of embodiment 2 recombinant vector

[0054] Construction of pBR322-rrs-Orip-EBNA1-rrs-EGFP:

[0055] The EF1a-EGFP-BGHpolyA in the pWPXL (purchased from Addgene) vector was inserted into pBR322-rrs-Orip-EBNA1-rrs-MCS using the BglII restriction site. Construction of pBR322-rrs-Orip-rrs-EBNA1-OSN:

[0056] 1) The open reading frame of Oct4 (NM_001159542) was amplified by PCR from human embryonic stem cell cDNA (primer sequence: P5': GGATCCATGGCGGGACACCTGGCTTC; P3': GAATTCGTTTGAATGCATGGGAGAGCC), and inserted into the PSP73 vector (purchased from Invitrogen) EF1a promoter via BamHI / EcoRI downstream. 2) Synthesize the 2A sequence (AAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGGGATGTAGAAAGCAATCCAGGTCCA), and use it as a template to amplify the 2A sequence with EcoRI and XhoI restriction sites (primer sequence: P5': GAATTCAAAATTGTCGCTCCTG; P3': CTCGAGTGGACCTGGATTGCT). Similarly, the Sox2 gene (NM_003106) was amplified by PCR from human embryonic...

Embodiment 3

[0062] Expression of embodiment 3 recombinant vectors in cells

[0063] The pBR322-rrs-Orip-EBNA1-rrs-EGFP vector constructed above was transfected into human foreskin fibroblasts (HFF) by electric shock method: 3.5 μg DNA / 1.0×10 6 The cells were transfected in 100 μl of amaxa buffer (purchased from LONZA Company, product number DPI-1002) using a nuclefector nuclear transfection apparatus with program U023. After 48 hours of transfection, add 100 μg / ml of G418 (Shanghai Haoran Biotechnology Co., Ltd.) for screening, and observe the expression of GFP all the time. The expression of GFP decreases with time, but GFP can continue to express under the pressure of G418 screening More than a month.

[0064] The above constructed pBR322-rrs-Orip-rrs-EBNA1-OSN and pBR322-rrs-Orip-rrs-EBNA1-MK vectors were transfected into human foreskin fibroblasts (HFF) by the same method as above. After transfection of HFF cells, samples were collected at different times for Western blot detection ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an expression system for a nonintegrated, long-time and erasable expression vector. The expression vector of the expression system adopts human herpes virus replication origin (Orip), an EBNA-1 expression box is introduced, and both ends of the Orip, both end of EBN-1 or both ends of Orip-EBNA-1 are provided with recombinase recognition sequences. The expression vector is not integrated in a cell genome, can stably express for a long time, can controllably erase vector plasmid by instantaneously inducing (or expressing) recombinase from a hose cell, can be applied to most kinds of cells by using a strong initiator and can distinguish a cell with the vector plasmid from a cell without the vector plasmid by using a real-time marker. The expression system can widely applied to mammal cell expression and biomedicine engineering for realizing cell reprogramming by expressing a foreign gene.

Description

technical field [0001] The invention relates to genetic engineering technology, in particular to an expression vector and an expression system based on the expression vector. Background technique [0002] There are various methods for expressing foreign genes in mammalian cells. For example, 1) Transfection of common plasmid (Plasmid DNA) can be used for non-integrated transient expression, and long-term expression of genes can also be achieved by integrating the plasmid into the genome; 2) Viral vectors that can be packaged into virus particles, such as Lentiviral vectors, retroviral vectors, etc., need to introduce exogenous genes into cells and integrate them into the genome of cells to express exogenous genes stably and long-term; 3) adenovirus (adenovirus) vectors can Genes are introduced into cells and expressed in cells in a non-integrated form, but this method can only achieve short-term expression of exogenous genes, and cannot achieve long-term (about one month) e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/869C12N5/10C12N5/00C12P21/00
Inventor 马跃马艳妮赵静
Owner INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com