Expression system for nonintegrated, long-time and erasable expression vector
A technology of expression vector and expression system, applied in the field of genetic engineering, can solve the problem that the deletion of foreign gene expression vector cannot be artificially controlled, and achieve the effect of long-term stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] The construction of embodiment 1 expression vector
[0050] Construction of pBR322-rrs-Orip-rrs-EBNA1-MCS:
[0051] 1) Synthesize primers with recombinase recognition sequences to obtain rrs-OriP-rrs (primer sequence: P5': GAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATTCCT; P3': AAGCTTATAACTTCGTATAGCATACATTATACGAAGTTATGCAG) from the pCEP4 vector (purchased from Invitrogen) by PCR, and introduce the enzyme at both ends Cutting sites EcoRI and HindIII, digested and inserted into PBR322 to obtain PBR322-rrs-OriP-rrs. 2) PCR amplified EBNA1 from the pCEP4 vector (primer sequence: P5': CGAGCTAGCATGTCTGACGAGGGGCCAGGTACAGG; P3': GGATCCTCTAGAAGATCTCTCGAGTCACTCCTGCCCTTCC), and introduced NheI at the 5' end and XhoI-BglII-XbaI-BamHI (hereinafter referred to as MCS) at the 3' end , Digested with NheI and BamHI and inserted into PBR322-rrs-OriP-rrs to obtain PBR322-rrs-OriP-rrs-(p)EBNA1-MCS. 3) PCR amplified IRES-neo (primer sequence: P5': GAATTCAGCTCGCTGATCAGCCCCCTCT; P3': TCTAGAGGATC...
Embodiment 2
[0053] The construction of embodiment 2 recombinant vector
[0054] Construction of pBR322-rrs-Orip-EBNA1-rrs-EGFP:
[0055] The EF1a-EGFP-BGHpolyA in the pWPXL (purchased from Addgene) vector was inserted into pBR322-rrs-Orip-EBNA1-rrs-MCS using the BglII restriction site. Construction of pBR322-rrs-Orip-rrs-EBNA1-OSN:
[0056] 1) The open reading frame of Oct4 (NM_001159542) was amplified by PCR from human embryonic stem cell cDNA (primer sequence: P5': GGATCCATGGCGGGACACCTGGCTTC; P3': GAATTCGTTTGAATGCATGGGAGAGCC), and inserted into the PSP73 vector (purchased from Invitrogen) EF1a promoter via BamHI / EcoRI downstream. 2) Synthesize the 2A sequence (AAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGGGATGTAGAAAGCAATCCAGGTCCA), and use it as a template to amplify the 2A sequence with EcoRI and XhoI restriction sites (primer sequence: P5': GAATTCAAAATTGTCGCTCCTG; P3': CTCGAGTGGACCTGGATTGCT). Similarly, the Sox2 gene (NM_003106) was amplified by PCR from human embryonic...
Embodiment 3
[0062] Expression of embodiment 3 recombinant vectors in cells
[0063] The pBR322-rrs-Orip-EBNA1-rrs-EGFP vector constructed above was transfected into human foreskin fibroblasts (HFF) by electric shock method: 3.5 μg DNA / 1.0×10 6 The cells were transfected in 100 μl of amaxa buffer (purchased from LONZA Company, product number DPI-1002) using a nuclefector nuclear transfection apparatus with program U023. After 48 hours of transfection, add 100 μg / ml of G418 (Shanghai Haoran Biotechnology Co., Ltd.) for screening, and observe the expression of GFP all the time. The expression of GFP decreases with time, but GFP can continue to express under the pressure of G418 screening More than a month.
[0064] The above constructed pBR322-rrs-Orip-rrs-EBNA1-OSN and pBR322-rrs-Orip-rrs-EBNA1-MK vectors were transfected into human foreskin fibroblasts (HFF) by the same method as above. After transfection of HFF cells, samples were collected at different times for Western blot detection ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com