Gene of recombinant staphylococal protein A, expression vector containing gene and application thereof

A staphylococcal protein and expression carrier technology, applied in the field of staphylococcal protein A genetic engineering, can solve the problems of difficulty in extracting protein A and failure to meet the needs of the biological industry, and achieve the effects of easy purification, increased stability and activity, and short production time

Active Publication Date: 2011-08-03
JIANGSU KANIONREAL BIOMEDICAL TECH CO LTD
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Protein A accounts for 1.7% of the body protein of staphylococcus, and staphylococcus is a pathogenic bacteria, so it is difficult to extract protein A from staphylococcus by traditional methods, and it has been unable to meet the growing biolo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of recombinant staphylococal protein A, expression vector containing gene and application thereof
  • Gene of recombinant staphylococal protein A, expression vector containing gene and application thereof
  • Gene of recombinant staphylococal protein A, expression vector containing gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Cloning of Staphylococcal Protein A Antibody Binding Region Gene

[0038] Synthesize the required primers by chemical synthesis (upstream 5'GGTCTCAAGGTAATGCTGCGCAACACG 3', downstream 5'CGCGGATCCTTAAGCATCGTTTAGCTTTTT 3'); use the PCR method to obtain the binding region gene of staphylococcal protein A antibody:

[0039] PCR system: 25μl system

[0040] 10×Buffer 2.5μl

[0041] dNTP 2μl

[0042] Primer 1.5μl×2

[0043] Template (DNA) 1μl

[0044] Sterile water 16μl

[0045] rTaq enzyme 0.5μl

[0046] Reaction program: 1: 95°C for 5min, 2: 95°C for 1min, 3: 57°C for 1min, 4: 72°C for 1min, 5: 2-4 cycle 24 times, 6: 72°C for 10min, 4°C for 1h;

[0047] The length of the amplified sequence is 867bp, and restriction sites BsaI and BamHI are respectively introduced into the two ends, including the stop codon TAA. See the above process figure 1 .

Embodiment 2

[0048] Example 2 Construction of Staphylococcal Protein A Antibody Binding Region Gene and pSUMO Vector

[0049] The recombinant staphylococcal protein A gene cloned in Example 1 was excised with restriction endonucleases BsaI and BamHI, and simultaneously combined with the pSUMO vector after being cut by the same enzyme (the construction of a high-efficiency soluble recombinant protein expression vector, Jiang Yuanyuan, Liu Mingyao, Ren Guiping , Zhu Huimeng, Li Deshan. Bioengineering Journal. 2010, 1, 25; 26(1): 121-129)) connected and transformed into Escherichia coli, screening transformants with kanamycin resistance, plasmid extraction, Enzyme digestion identification and sequencing proved that the binding region gene of the staphylococcal protein A antibody had been cloned into the pSUMO vector. See the above process figure 1 .

Embodiment 3

[0050] Example 3 Construction of Escherichia coli strain E.coliRosetta / p-SUMO-SPA capable of highly expressing recombinant staphylococcal protein A

[0051] Transform p-SUMO-SPA into E.coli Rosetta (purchased from Beijing Quanshijin Biotechnology Co., Ltd., product code CD801) by chemical transformation method, screen transformants on LB plate containing kanamycin, and extract the plasmid , Recombinant E.coli Rosetta / p-SUMO-SPA obtained by enzyme digestion identification and sequencing analysis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a gene of a recombinant staphylococal protein A and application thereof. The nucleotide sequence of the gene of the recombinant staphylococal protein A is shown as SEQ ID NO:1; and the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO:2. The staphylococal protein A is fused with small ubiquitin to form the gene of the recombinant staphylococal protein A; the expressed recombinant protein facilitates purifying the protein and improves the stability and activity of the protein; and experiments prove that the bioactivity of the expressed recombinant staphylococal protein A is not obviously different from that of a natural staphylococal protein A. The recombinant staphylococal protein expression and purification method has the advantages of short production time, high expression efficiency, high expression level, simple purification and the like.

Description

technical field [0001] The present invention relates to a rearranged gene, especially to a recombinant staphylococcal protein A gene. The present invention also relates to an expression vector containing the gene and an engineering strain. The present invention further relates to their use in preparing staphylococcal protein A, which belongs to Grape Coccin A genetic engineering field. Background technique [0002] Staphylococcus protein A (SPA) is a protein isolated from the cell wall of Staphylococcus aureus. Staphylococcus is a Gram-positive bacterium, the most common pyogenic coccus, and an important source of hospital cross-infection. The diameter of the bacteria is about 0.8mm, small spherical, often piled up into bunches of grapes, but in the early culture of liquid medium, they are often dispersed, and the bacteria cells exist alone. As early as 1940, Verwey found that some Staphylococcus aureus contained a substance that could form a precipitate with normal human ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/31C12N15/63C07K14/31C12N1/19C12N1/21C12N1/15C07K1/14
Inventor 李德山高学慧任桂萍王文飞刘铭瑶
Owner JIANGSU KANIONREAL BIOMEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap