Gene of recombinant staphylococal protein A, expression vector containing gene and application thereof
A staphylococcal protein and expression carrier technology, applied in the field of staphylococcal protein A genetic engineering, can solve the problems of difficulty in extracting protein A and failure to meet the needs of the biological industry, and achieve the effects of easy purification, increased stability and activity, and short production time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Cloning of Staphylococcal Protein A Antibody Binding Region Gene
[0038] Synthesize the required primers by chemical synthesis (upstream 5'GGTCTCAAGGTAATGCTGCGCAACACG 3', downstream 5'CGCGGATCCTTAAGCATCGTTTAGCTTTTT 3'); use the PCR method to obtain the binding region gene of staphylococcal protein A antibody:
[0039] PCR system: 25μl system
[0040] 10×Buffer 2.5μl
[0041] dNTP 2μl
[0042] Primer 1.5μl×2
[0043] Template (DNA) 1μl
[0044] Sterile water 16μl
[0045] rTaq enzyme 0.5μl
[0046] Reaction program: 1: 95°C for 5min, 2: 95°C for 1min, 3: 57°C for 1min, 4: 72°C for 1min, 5: 2-4 cycle 24 times, 6: 72°C for 10min, 4°C for 1h;
[0047] The length of the amplified sequence is 867bp, and restriction sites BsaI and BamHI are respectively introduced into the two ends, including the stop codon TAA. See the above process figure 1 .
Embodiment 2
[0048] Example 2 Construction of Staphylococcal Protein A Antibody Binding Region Gene and pSUMO Vector
[0049] The recombinant staphylococcal protein A gene cloned in Example 1 was excised with restriction endonucleases BsaI and BamHI, and simultaneously combined with the pSUMO vector after being cut by the same enzyme (the construction of a high-efficiency soluble recombinant protein expression vector, Jiang Yuanyuan, Liu Mingyao, Ren Guiping , Zhu Huimeng, Li Deshan. Bioengineering Journal. 2010, 1, 25; 26(1): 121-129)) connected and transformed into Escherichia coli, screening transformants with kanamycin resistance, plasmid extraction, Enzyme digestion identification and sequencing proved that the binding region gene of the staphylococcal protein A antibody had been cloned into the pSUMO vector. See the above process figure 1 .
Embodiment 3
[0050] Example 3 Construction of Escherichia coli strain E.coliRosetta / p-SUMO-SPA capable of highly expressing recombinant staphylococcal protein A
[0051] Transform p-SUMO-SPA into E.coli Rosetta (purchased from Beijing Quanshijin Biotechnology Co., Ltd., product code CD801) by chemical transformation method, screen transformants on LB plate containing kanamycin, and extract the plasmid , Recombinant E.coli Rosetta / p-SUMO-SPA obtained by enzyme digestion identification and sequencing analysis.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 