Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum

A technology of Fusarium graminearum and typing method, which is applied in the field of genotyping and detection of Fusarium graminearum resistance to carbendazim, which can solve the problem of time-consuming, heavy workload, and inability to predict drug-resistant diseases in the early stage Pop and other issues

Inactive Publication Date: 2011-03-23
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional resistance detection method is based on the inhibitory effect of different doses of chemicals on the growth of mycelia, which takes a long time, and the workload of determining the level of drug resistance is greater, and it is impossible to predict the prevalence of drug-resistant diseases in the early stage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum
  • Genotyping detection method of drug resistance to Sanmate of Fusarium graminearum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Embodiment 1, detect the genotype strain (position 167) of point mutation in the 167th codon

[0101] Extract bacterial strain ZF-43, ZF-21, ZF-52, R9 genomic DNA, use the specific primer amplification pair that amplifies Fusarium graminearum β2-tubulin gene to comprise 167 codon DNA fragments:

[0102] F-out167 5′GACCACCTTCAGGGTTTCCAGCTGACGC 3′

[0103] R-out167 5′GATCGGCGTACGAAGGATCGGCGATCTT 3′

[0104] F-in167T 5′GTTCCCCGATCGCATGATGGCCACTTT 3′

[0105] R-in167A 5′GAAACCTTGGGCGAGGGCATAACGGGAT 3′

[0106] 25 μl PCR system contains 2 μl DNA template, 2.5 μl 10× buffer, 2 μl dNTP (2.5 mM each), 1.5 μl MgCl2 (25 mM), 0.2 μl each of F-out167 / R-out167 (10 μM), F-in167T (10 μM) 0.5 μl, 0.8 μl of R-in167A (10 μM), 1 U of TaqDNA polymerase (Dalian Biotech, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.), and the reaction conditions were: 94°C for 5 min; 35 cycles of 94°C for 15 s, 66°C for 30 s, and 72°C for 30 s; 72°C for 5 min; and stored at 4°C. Get 8 ...

Embodiment 2

[0108] Embodiment 2, detection of the genotype strain (position 198) in which a point mutation occurs in the 198th codon

[0109] Extract bacterial strain ZF43, ZF-21, J2, ZF43-6 genomic DNA, use the specific primer amplification pair that amplifies Fusarium graminearum β2-tubulin gene to comprise 198 codon DNA fragments:

[0110] F-out198 5′AGCTCGTTGAGGAAGCCATTGATGTT 3′

[0111] R-out198 5′CATGTTAACAGCGAGCTTTCGCAGAT 3′

[0112] F-in198A 5′GAACCAGCTCGTCGAGAACTCTGCCA 3′

[0113] R-in198G 5′GAGCCTCGTTATCGATACAGAAGGTATC 3′

[0114] 25 μl PCR system contains 2 μl DNA template, 2.5 μl 10× buffer, 2 μl dNTP (2.5 mM each), 1.5 μl MgCl2 (25 mM), 0.4 μl each of F-out198 / R-out198 (10 μM), F-in198A (10 μM) 0.15 μl, R-in198G 0.4 μl, TaqDNA polymerase 1U (Dalian Takara, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.), and the reaction conditions were: 94°C for 5 minutes; 35 cycles of 94°C for 15s, 65°C for 30s, and 72°C for 30s; 72°C for 5 minutes; and stored at 4°C. ...

Embodiment 3

[0116]Embodiment 3, detection of the genotype strain (position 200) in which a point mutation occurs in the 200th codon

[0117] Extract bacterial strain ZF43, ZF-21, NT-7, t1 genomic DNA, amplify the DNA fragment specific primer pair that contains 200 codons with amplifying Fusarium graminearum β2-tubulin gene:

[0118] F-out200 5′ACAACTGGGCCAAGGGTCATTACACC 3′

[0119] R-out200 5′AAGTCGGGGGAACGGAATCATGTTAAC 3′

[0120] F-in200T 5′CCAGCTCGTCGAGAACTCTGACGAGACTTT 3′

[0121] R-in200A 5′TCGTACAGAGCCTCGTTATCGATACGGT 3′

[0122] 25μl PCR system contains 2μl DNA template, 2.5μl 10×buffer, 2μl dNTP (2.5mM each), 1.5μl MgCl2 (25mM), 0.8μl each of F-out200 / R-out200 (10μM), F-in200T / R- 0.5 μl each of in200A (10 μM), and 1 U of TaqDNA polymerase (Dalian Biotech, Takara). The reaction was carried out on PTC-200 (Bio-rad, Inc.), and the reaction conditions were: 94°C for 5 min; 35 cycles of 94°C for 15 s, 55°C for 30 s, and 72°C for 30 s; 72°C for 5 min; and stored at 4°C. Get 8 μ l o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to a Sanmate resistance genotype molecular detection and SNP typing method of Fusarium graminearum, which can be used for drug resistance monitoring and drug resistance genotype diagnosis to Sanmate and other benzimidazole type bactericides of the Fusarium graminearum which can cause wheat scab. The detection method comprises the following three major steps: (1) extracting DNA of a nuclear genome of a strain to be detected; (2) applying three groups of primer pairs to carry out PCR reaction; and (3) identifying the genotype of the strain with the resistance to the Sanmate according to a PCR product electrophoretogram. By adopting the Tetra-primer ARMS PCR (Tetra-primer amplification refractorymutation system-PCR) technology, the strain with the drug resistance of theFusarium graminearum and the genotype thereof can be fast and accurately detected, and the level of the drug resistance can be further judged. The detection accuracy is above 95%.

Description

1. Technical field [0001] The invention belongs to a method for molecular detection and SNP typing of the carbendazim-resistant strain genotype of Fusarium graminearum, which can be used for the diagnosis and treatment of benzimidazole fungicide (carbendazim)-resistant Fusarium graminearum The dynamic monitoring of the development of drug-resistant pathogen populations can predict the prevalence of wheat head blight at different levels of drug resistance; it can also carry out SNP typing to provide a theoretical basis for drug resistance management at the molecular level. 2. Technical background [0002] Wheat scab is a worldwide disease caused by Fusarium graminearum Schwabe, which seriously affects the yield and quality of wheat. For a long time, benzimidazole fungicides or compound agents based on such agents have been used for chemical control. Benzimidazole fungicides are used in production as a class of high-efficiency, broad-spectrum systemic fungicides, which solve ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor周明国陈长军王建新罗卿权
OwnerNANJING AGRICULTURAL UNIVERSITY