Construction and applications of cell model expressing human organic cation transporter-1
A cell model and cell technology, applied in the direction of cells modified by introducing foreign genetic material, application, microorganism measurement/inspection, etc., can solve problems such as unclear three-dimensional structure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] 1. Preparation of target gene
[0026] 1.1 Obtaining the wild-type target gene
[0027] (1) Design two PCR primers according to the DNA sequence of human OCT1. The upstream and downstream primers respectively design a restriction site, BamHI, XhoⅠ (underlined)
[0028] SEQ ID No:4 upstream primer: ATG GGATCC ATGCCCACCGTGGATGACAT
[0029] SEQ ID No:5 downstream primer: ATG CTCGAG TCAGGTGCCCGAGGGTTCT
[0030] (2) Total RNA was extracted from human liver tissue by TRIzol method, cDNA was obtained by RT-PCR, and the target gene fragment was obtained using cDNA as a template.
[0031]
[0032] The PCR result was identified by 1% agarose gel electrophoresis, and a band with a length of about 1.7kb was obtained (see figure 1 A), the position is correct, and the target gene is considered to be obtained.
[0033] (3) Gel recover the PCR product at the correct position, and perform A addition reaction on the recovered product. The reaction product is identified by ele...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
