Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof
A detection kit and detection method technology, applied in the field of biomedicine, can solve the problems of early diagnosis of uncomfortable diseases and little significance of clinical diagnosis and treatment, and achieve the effects of rigorous design, high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0057] The invention discloses a specific PCR detection kit for Pneumocystis sp. and a detection method thereof.
[0058] Below in conjunction with embodiment detailed further description:
[0059] (1) Pneumocystis specific diagnostic sequence:
[0060] Pneumocystis mitochondrial large subunit rRNA gene, this gene is shared by all species of Pneumocystis and has the least inter-species variation. The conserved part of the sequence is compared in NCBI as shared by multiple Pneumocystis species , and the homology is greater than 70%, meeting the genus-specific detection criteria. Its sequence is:
[0061] GTGTACGTTGCAAAGTACTCAGAAGAATTGTGGTAAGTAGTGAAATACAAATCGGGCTAGGATATAGCTGGTTTTCTGCGAAAATTGTTTTGGCAAATTG TTTATTCCTCTAAAAAATAGTAGGTATAGCACTGAATATCTCGAGGGAGTATGAAAATATTTATCTCAGATATTTAATCTCAAAATAACTATTTCTTAA A ATAAATAATCAGACTATGTGCGATAAGGTAGATAGTCGAAAGGGAAACAGCCCAGAACAGTAATTAAAGCTCCCCAATTAATATTAAGTGAAATAAAA
[0062] (2), the composition of PCR detection kit:
[0063] (1) DNA lysate:...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com