Supercharge Your Innovation With Domain-Expert AI Agents!

Rna interference mediated inhibition of the intercellular adhesion molecule 1 (icam-1)gene expression using short interfering nucleic acid (sina)

A technology that interferes with nucleic acids and molecules, applied in DNA/RNA fragments, genetic engineering, recombinant DNA technology, etc., can solve problems that hinder the development of effective vaccines

Inactive Publication Date: 2012-05-02
SCHERING AG
View PDF166 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are more than 100 unique serotypes of HRV and this has hampered the development of an effective vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rna interference mediated inhibition of the intercellular adhesion molecule 1 (icam-1)gene expression using short interfering nucleic acid (sina)
  • Rna interference mediated inhibition of the intercellular adhesion molecule 1 (icam-1)gene expression using short interfering nucleic acid (sina)
  • Rna interference mediated inhibition of the intercellular adhesion molecule 1 (icam-1)gene expression using short interfering nucleic acid (sina)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0616] Example 1: Design, synthesis and identification of siNAs active against ICAM-1

[0617] ICAM-1 siNA synthesis

[0618] A series of 42 siNA molecules were designed, synthesized and evaluated for efficacy against ICAM-1. The main criteria for ICAM-1 design for human siNAs were (i) homology to ethnicity, and (ii) high power score as determined by a proprietary algorithm. Mouse sequences were also investigated for use in animal models. The effect of siNA on ICAM-1 RNA levels was also examined. The siNA sequences designed, synthesized and evaluated for efficacy against ICAM-1 are described in Table 1a (target sequences) and Table 1b (modified sequences).

[0619]Table 1a: ICAM-1 Target Sequences, Target Sites Indicated. Homology column indicates complete homology of siNA to human transcript (h), or mouse transcript (m).

[0620] duplex ID target sequence target site homology SEQ ID NO: 29281-DC CAGUGACUGUCACUCAGAGA 1650 h 1 29282-DC ...

Embodiment 2

[0692] Example 2: In vitro evaluation of siNA in human bronchial epithelial cells

[0693] Maximize ICAM-1 mRNA knockdown and potency in human bronchial epithelial cells as follows ( EC50) siNAs corresponding to duplex ID numbers 29961-DC, 29964-DC, 29984-DC, 29988-DC, 29957-DC, 29947-DC and 29956-DC were tested.

[0694] Cell culture preparation:

[0695] Human bronchial epithelial cells (NHBE cells) from Lonza (Cat. No. CC-2540) were grown at 37 °C in the presence of 5% CO2 and grown in BEBM minimal medium (Lonza, Cat. No. CC-3171) on Biocoat collagen 1 coated culture flask (Becton Dickinson).

[0696] Human lung epithelial carcinoma (Calu-1) cells were grown at 37°C in the presence of 5% CO2 and cultured in DMEM supplemented with 10% fetal bovine serum, glutamine, and antibiotics.

[0697] Transfection:

[0698] NHBE cells were plated in collagen 1-coated plates and cultured in appropriate medium. Cells were incubated at 37° C. for 24 hours in the presence of 5% C...

Embodiment 3

[0715] Example 3: Testing of siNAs for TLR3-mediated immune stimulation

[0716] Calu-1 or NHBE cells were processed as described above in Example 2 and used to measure endosomal TLR3-mediated immune stimulation, including poly I:C as a positive control for OAS1 mRNA upregulation. For the measurement of membrane-bound TLR3-mediated immune stimulation, Calu 1 cells were cultured at 12000 cells / 96 wells and administered at 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 0.3 nM in the absence of delivery vehicle in siRNA in PBS.

[0717] Endosomal TLR3-mediated expression was also measured by recording the percent increase in OAS1 mRNA levels when NHBE cells were transfected with siNA formulated with the delivery vehicle (Gemini Surfactant GSC170 Dab - Example 37 in WO03 / 82809). Immunostimulation (percentage increase in OAS1 mRNA levels relative to Gemini delivery vehicle). The TLR3 agonist Poly I:C was used as a positive control for OAS1 mRNA induction.

[0718] The results of the above im...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of ICAM-1 gene expression and / or activity, and / or modulate a ICAM-1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against ICAM-1 gene expression.

Description

[0001] sequence listing [0002] This application claims the benefit of US Provisional Application No. 61 / 164,314, filed March 27, 2009. The applications listed above, including the drawings, are hereby incorporated by reference in their entirety. [0003] sequence listing [0004] Pursuant to 37 CFR §1.52(e)(5), the sequence listing submitted via EFS is incorporated herein by reference. Sequence Listing text files submitted via EFS include file "SequenceListing84WPCT" created on March 19, 2010, which is 113,421 bytes in size. Background of the invention [0005] Intercellular adhesion molecule 1 (ICAM-1, CD54) is involved in leukocyte adhesion-mediated inflammatory functions. It belongs to the immunoglobulin superfamily of cell adhesion molecules. Human ICAM-1 has five "Ig-like" extracellular domains, a transmembrane domain and a short C-terminal cytoplasmic domain. ICAM-1 is expressed on the surface of leukocytes, fibroblasts, epithelial cells and endothelial cells. IC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113
CPCC12N2310/317C12N2310/14C12N2310/321C12N2310/322C12N15/1138A61P11/00A61P11/02A61P11/06A61P11/14C12N2310/3521C12N2310/3533A61K31/7088C12N15/113C12Q2600/178
Inventor W.斯特拉普斯J.沙V.皮克林
Owner SCHERING AG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More