Anti-tumor effect, implementation method and use of miRNA
A technology of mir-199a and rnamir-199a, applied in the fields of biotechnology and medicine, can solve the problems such as the lack of miR-199a/b-3p, the difficulty of screening miRNA, and the different functions.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1: The relationship between the expression level of miR-199a / b-3p and HCC
[0069] The expression of miR-199a / b-3p in HCC tissues and paracancerous tissues (from the specimen bank of Oriental Hepatobiliary Hospital) collected from 142 HCC patients collected from 2002 to 2006 by real-time quantitative reverse transcription PCR (qRT-PCR) Analyzed.
[0070] Total tissue RNA was extracted using TRIzol (Invitrogen). qRT-PCR was completed on LightCyclerl.5 (Roche Company) real-time quantitative PCR instrument using SYBR RT-PCR kit (Takara Company).
[0071] The reverse transcription primer of miR-199a / b-3p is: 5′-GTC GTA TCC AGT GCA GGG TCCGAG GTA TTC GCA CTG GAT ACG ACT AAC CA-3′ (SEQ ID NO: 2);
[0072] Quantitative PCR primer: 5'-GTCACAGTAGTCTGCACAT-3' (upstream, SEQ ID NO: 3)
[0073] and 5'-GTGCAGGGTCCGAGGT-3' (downstream, SEQ ID NO: 4).
[0074] The reverse transcription reaction primer of the internal reference U6 small nuclear RNA is the same ...
Embodiment 2
[0089] Example 2: miR-199a / b-3p inhibits the growth of HCC cells in vitro
[0090] The following sequences (synthesized by Shanghai Gemma Company) were used to make miR-199a / b-3p highly expressed in the human HCC cell line Hep3B cells:
[0091] miR-199a / b-3p: ACAGUAGUCUGCACAUUGGUUA (SEQ ID NO: 1)
[0092] Control RNA: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 7, TT protruding at the 3′ end is a commonly used modification method in the synthesis of small RNA sequences, which has no effect on its function, mainly to stabilize nucleotides [Wilda, M. et al. , Killing of leukemic cells with a BCR / ABL fusion gene by RNA interference (RNAi). Oncogene. 2002; 21: 5176-5124]).
[0093] Human HCC cell line Hep3B cells were purchased from Shanghai Institute of Biochemical Cells, Chinese Academy of Sciences. Use INTERFERin transfection reagent (Polyplus company) to transfect small RNA, the final concentration of miR-199a / b-3p transfection is 10nM and / or 50nM, the control RNA transfection conce...
Embodiment 3
[0100] Example 3: Reduced expression of miR-199a / b-3p in nude mice human liver cancer tumor-bearing model SMMC-LTNM
[0101] Construct the human primary HCC subcutaneous tumor-bearing nude mouse model SMMC-LTNM according to the literature method [Tao, WZ. et al., The tumor invasion and metastasis in the transplantation of transplanted human hepatocellular carcinoma into nude mice abdominal cavity and orthotopic tissue. Dier Junyi Daxue Xuebao .1998;19:54-56]. According to literature reports, compared with the nude mouse tumor-bearing model constructed by routinely used HCC cell lines, SMMC-LTNM is more similar to the clinical progress of human HCC. It can cause local invasion and metastasis to other organs, and can also secrete a large amount Alpha-fetoprotein (alpha-fetoprotein, AFP).
[0102] Utilize the qRT-PCR method described in Example 1 to detect the expression of miR-199a / b-3p in human normal liver tissue (from the Oriental Hepatobiliary Hospital Specimen Bank) and ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More