Unlock instant, AI-driven research and patent intelligence for your innovation.

Reporter gene plasmid vector, construction method and application

A reporter gene, plasmid vector technology, applied in the field of molecular biology, can solve the problems of restricted regulation, technical difficulties of large fragments of DNA, etc., and achieve the effect of system stability

Inactive Publication Date: 2012-06-27
XINXIANG MEDICAL UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006]At present, due to the technical difficulties in the study of large fragments of DNA (>10 kb), the research on the regulation of the upstream of the core activation region of human genes has been limited for a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reporter gene plasmid vector, construction method and application
  • Reporter gene plasmid vector, construction method and application
  • Reporter gene plasmid vector, construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of pBeloBAC11-I plasmid

[0029] 1) From the pGL3-enhancer vector not I / Bam HI site enzyme cleavage includes synthetic poly (A), multiple cloning site, luciferase reporter gene ( luc +) fragments. The enzyme digestion system is as follows:

[0030]pGL3-enhancer vector 0.4μg (1 μl)

[0031] BSA 0.5 μl

[0032] NotI 0.5 μl

[0033] Bam HI 0.5 μl

[0034] 10×NEBBuffer 3 5 μl

[0035] h 2 O 42.5 μl

[0036] 37°C, 2 h.

[0037] 2) 1.5% agarose gel electrophoresis, using the QIAquick Gel Extraction Kit to recover DNA fragments from the gel.

[0038] 3) T4 DNA polymerase, so that step 2) includes synthetic poly (A), multiple cloning sites, luciferase reporter gene ( luc +) DNA fragments form blunt ends.

[0039] 4) 1.5% agarose gel electrophoresis, QIAquick Gel Extraction Kit, gel recovery DNA fragments.

[0040] 5) Srf I digest pBeloBAC11, the enzyme digestion system is

[0041] pBeloBAC11 vector 0.4 μg (1 μl)

[0042] BSA 0....

Embodiment 2

[0056] Example 2: Construction of pBeloBAC11-I1 reporter gene plasmid vector

[0057] 1) Use the pGL3-enhancer vector as a template to amplify the SV40 late poly(A) fragment by PCR. Primer F: 5'-CCCCC ACATGT CAGACATGATAAGATACATTGAT ( Pci I site underline ), Primer R: 5'-TTTTTT GGTAACC TACCACATTTGTAGAGGTTTTAC ( Bst EII site is underlined). PCR reaction system:

[0058] h 2 O 42 μl

[0059] 10X Pfu Buffer 5 μl

[0060] 10mM dNTP 1 μl

[0061] Template 100ng

[0062] Primers 0.2μl

[0063] Pfu 1 μl

[0064] Total 50 μl

[0065] PCR Conditions Adoption Procedure:

[0066] 95°C for 5 min; 95°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 2 min. The PCR products were electrophoresed in 2 μl gel, and the bands were clear and single.

[0067] 2) Purification step 1) PCR product. Add 5 μl of 5 M NH4Ac to the PCR product, after mixing, add 125 μl of 100% ethanol, -80°C, 4 h, 14,000 rpm, 4°C, 30 min. Discard the supernatant, add 0.3 ml of 70% e...

Embodiment 3

[0090] Example 3: Construction of pBeloBAC11-II plasmid

[0091] 1) From the pGL3-enhancer vector Bgl I / Sal I site digestion includes synthetic poly (A), multiple cloning site, luciferase reporter gene ( luc +) fragments. The enzyme digestion system is as follows:

[0092] pGL3-enhancer vector 0.4μg (1 μl)

[0093] BSA 0.5 μl

[0094] Bgl I 0.5 μl

[0095] Sal I 0.5 μl

[0096] 10×NEBBuffer 3 5 μl

[0097] h 2 O 42.5 μl

[0098] Temperature 37 degrees, 2 hours.

[0099] 2) 1.5% agarose gel electrophoresis, using the QIAquick Gel Extraction Kit to recover DNA fragments from the gel.

[0100] 3) T4 DNA polymerase, so that step 2) includes synthetic poly (A), multiple cloning sites, luciferase reporter gene ( luc +) DNA fragments form blunt ends.

[0101] 4) 1.5% agarose gel electrophoresis, QIAquick Gel Extraction Kit, gel recovery DNA fragments.

[0102] 5) T4DNA ligase ligation step 4) and Example 1 Step 6) got Srf I linearize the pBeloBAC11 vector, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a reporter gene plasmid vector and a transformant for providing the reporter gene plasmid vector. The invention also discloses a construction method for the reporter gene plasmid vector. The constructed reporter gene plasmid vector is used for DNA fragment expression control activity research of 10-300kb of a eukaryote.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a reporter gene plasmid vector, construction method and application. Background technique [0002] A reporter gene is a gene that encodes a protein or enzyme that can be detected. Its coding sequence is fused with the gene expression regulatory sequence to form a chimeric gene, or fused with other target genes, and expressed under the control of the regulatory sequence, so that its expression product can be used to mark the expression regulation of the target gene. Currently commercial human and mammalian cell reporter plasmid vectors, such as the pGL3 series, are difficult to accommodate DNA fragments of more than 10 kb due to the small capacity of the vectors, and are often used for core promoters, or research on the regulatory activity of DNA fragments less than 10 kb. [0003] At present, the research on the promoter activity of human genes mainly focuses on the promoter cor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/65C12N15/85C12N15/66C12Q1/68
Inventor 赵营翟德胜梁金英袁会峰李宏彬杨俊马丽娟李娜朱茉莉李嵩箕
Owner XINXIANG MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com