A method for screening metal matrix protease inhibitors at the cell level
A technology of protease inhibitors and metal substrates, applied in biochemical equipment and methods, measurement/testing of microorganisms, fluorescence/phosphorescence, etc., can solve problems such as inability to simulate the mode of action of MMP, achieve good application prospects, and facilitate and rapid detection Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] The embodiment takes MMP-13 as an example, but this patent is not limited to MMP-13, and can also be used for other metal matrix proteases. In this example, Retro-X Tet-Off Advanced Inducible Expression System from Clontech Company was used, including: pRetroX Tet-Off plasmid, pRetroX-Tight-Pur plasmid and pRetroX-Tight-Pur-luc control plasmid. GP293 cells were used as packaging cells. PCS-100-011 was used as target cells.
[0020] (1) Construction of MMP-13 expression plasmid:
[0021] ① Total RNA extraction: Total RNA was extracted with Trizol from UT-SCC-7 cells treated with TNF-α. Then M-MuLV reverse transcriptase, oligo(dT) was used as a primer. The first strand of cDNA was obtained by reverse transcription.
[0022] ②Amplification of MMP-13 full-length cDNA: upstream primer: TGAGGATCCATGCATCCAGGGTCCTGGC; downstream primer: AGCTCGCGACTTAACACCACAAAATGG. The annealing temperature is 65°C-55°C drop PCR, 72°C extension for 2min, 40 cycles. The length of the PCR p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap