A method for screening metal matrix protease inhibitors at the cell level

A technology of protease inhibitors and metal substrates, applied in biochemical equipment and methods, measurement/testing of microorganisms, fluorescence/phosphorescence, etc., can solve problems such as inability to simulate the mode of action of MMP, achieve good application prospects, and facilitate and rapid detection Effect

Active Publication Date: 2016-08-24
SHANGHAI GENEXT MEDICAL TECH +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing screening methods for MMP inhibitors in vitro cannot simulate the mode of action of MMPs in vivo. Many studies have proved that soluble MMPs (such as: -1.-13, -2, -9) cannot mediate the invasion of tumor cells ability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for screening metal matrix protease inhibitors at the cell level

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The embodiment takes MMP-13 as an example, but this patent is not limited to MMP-13, and can also be used for other metal matrix proteases. In this example, Retro-X Tet-Off Advanced Inducible Expression System from Clontech Company was used, including: pRetroX Tet-Off plasmid, pRetroX-Tight-Pur plasmid and pRetroX-Tight-Pur-luc control plasmid. GP293 cells were used as packaging cells. PCS-100-011 was used as target cells.

[0020] (1) Construction of MMP-13 expression plasmid:

[0021] ① Total RNA extraction: Total RNA was extracted with Trizol from UT-SCC-7 cells treated with TNF-α. Then M-MuLV reverse transcriptase, oligo(dT) was used as a primer. The first strand of cDNA was obtained by reverse transcription.

[0022] ②Amplification of MMP-13 full-length cDNA: upstream primer: TGAGGATCCATGCATCCAGGGTCCTGGC; downstream primer: AGCTCGCGACTTAACACCACAAAATGG. The annealing temperature is 65°C-55°C drop PCR, 72°C extension for 2min, 40 cycles. The length of the PCR p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a method for screening metal matrix protease inhibitors at the cell level, comprising: (1) designing primers to amplify the full-length cDNA of metal matrix proteases by PCR; (2) constructing expression using Retro X Tet Off as a carrier system; (3) transfect the cell line with the vector constructed above, and screen positive clones, and when the cells cover the bottom of the dish, replace the culture medium with a DOX-free medium to induce the expression of MMPs; (4 ) to screen out matrix metalloproteinase inhibitors. The present invention establishes a method based on the Tet-off expression system, which can simulate the action environment of MMP to the greatest extent, and is used for the screening of MMP inhibitors, which is more accurate than the in vitro screening of general metal matrix protease inhibitors.

Description

technical field [0001] The invention belongs to the field of screening drugs, in particular to a method for screening metal matrix protease inhibitors at the cell level. Background technique [0002] The degradation of the extracellular matrix is ​​the prerequisite for tumor cell migration and infiltration of the matrix, and it is also a major change after the adhesion of tumor cells to the matrix. Matrix metalloproteinases (MMPs) are the most important enzymes regulating the homeostasis of the extracellular matrix. Therefore, MMP is an important target for the treatment of cancer and tumors. However, the existing screening methods for MMP inhibitors in vitro cannot simulate the mode of action of MMPs in vivo. Many studies have proved that soluble MMPs (such as: -1.-13, -2, -9) cannot mediate the invasion of tumor cells ability. [0003] In 1992, Gossen et al. successfully constructed a tetracycline (tetracycline, Tet) eukaryotic cell gene regulatory expression system usi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/02G01N21/64
Inventor 鲁晓锋史小娟
Owner SHANGHAI GENEXT MEDICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap