Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular marker closely linked with major quantitative trait locus (QTL) of thousand-grain weight and grain length of wheat and obtaining method and application of molecular marker

A technology of molecular markers and acquisition methods, which is applied in the fields of biochemical equipment and methods, recombinant DNA technology, and microbial determination/inspection, etc., can solve the problem of no molecular markers, and achieve rapid and accurate screening, production cost savings, and selection goals. clear effect

Inactive Publication Date: 2012-09-26
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no molecular marker report linked to the QTL of the main effect number loci of thousand-grain weight and grain length

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker closely linked with major quantitative trait locus (QTL) of thousand-grain weight and grain length of wheat and obtaining method and application of molecular marker
  • Molecular marker closely linked with major quantitative trait locus (QTL) of thousand-grain weight and grain length of wheat and obtaining method and application of molecular marker
  • Molecular marker closely linked with major quantitative trait locus (QTL) of thousand-grain weight and grain length of wheat and obtaining method and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A molecular marker closely linked to major QTLs for thousand-grain weight and grain length in wheat,

[0035] labeled primers wmc386 ,

[0036] The left end primer sequence ATCACTGAAACGAAATGAGCGG (as described in SEQ ID NO: 1)

[0037] Right end primer sequence TGGTTGGCGGTTTTTCTCTACA (as described in SEQ ID NO: 2)

[0038] and labeled primer barc216,

[0039] Left end primer sequence TGACGACCCAATCCATAGACA (as described in SEQ ID NO:3)

[0040] Right end primer sequence GGTGATTATTCGTGAGTTCCCTGTG (as described in SEQ ID NO:4)

[0041] The DNA of wheat line Shannong 0431 was amplified by PCR, and the PCR amplification system was 20 μl, H 2 O 5.75 μl, 10×PCR buffer 10.0 μl, Taq enzyme 0.25 μl, left and right end primers 2.0 μl, DNA 2.0 μl; amplification conditions were pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s, annealing at 55°C for 45 s, Extend at 72°C for 50 s, 35 cycles; extend at 72°C for 10 min; store at 10°C; the model of the PCR machine ...

Embodiment 2

[0056] The molecular markers closely linked to the major QTLs of wheat thousand-grain weight and grain length provided by the present invention were tested in the F family of wheat line Shannong 0431. 7 Application of 18 derived lines in generation RIL population and Lumai 21

[0057] Using Shannong 0431, a line with large grains, disease resistance, and resistance to dry and hot wind, as the female parent, and Lumai 21, a small-grained, multi-eared variety, as the male parent, F 7 The recombinant inbred line population (RIL population) was used to map the QTL for grain-yield-related traits and screen for molecular markers closely linked to the main QTL. The specific steps are as follows:

[0058] (1) 18 derived strains from the RIL population of the wheat variety Shannong 0431 were planted in the field, and the leaves of the plants of each strain were separated and extracted using the improved CTAB method;

[0059] The derivative varieties or strains of the wheat line Shann...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker closely linked with a major quantitative trait locus (QTL) of the thousand-grain weight and grain length of wheat and an obtaining method and application of the molecular marker. A labeling primer wmc386 and barc216 are adopted to carry out polymerase chain reaction (PCR) amplification on the DNA of a wheat line Shannong 0431; and after the electrophoretic separation of the amplification product on 8% polyacrylamide gel, the molecular weights of the obtained amplification product are 190 bp and 100 bp respectively, i.e., the molecular marker of the major QTL of the thousand-grain weight and the grain length of the wheat. The molecular marker of the major QTL of the thousand-grain weight and the grain length of the wheat can be used for detecting whether the QTL for increasing the thousand-grain weight and the grain length is contained in a wheat variety or a wheat line, in order to fast screen out the wheat variety or the wheat line containing the QTL for increasing the thousand-grain weight and the grain length for breading; therefore, the selective breeding process for high-yield wheat varieties is much faster.

Description

technical field [0001] The invention relates to the application field of wheat molecular biotechnology and breeding, in particular to a molecular marker closely linked to the main QTL for increasing wheat thousand-grain weight and grain length, an acquisition method and application thereof. Background technique [0002] Wheat is one of the most important food crops in the world, so the breeding of high-yielding wheat varieties has always been highly valued by breeders. Wheat yield traits are complex quantitative traits controlled by multiple quantitative trait loci (Quantitative trait loci, QTL). , Traditional breeding methods often have the problems of long time, large consumption, high cost and small results. Molecular marker-assisted breeding is an effective method of breeding using molecular markers associated with specific traits as an auxiliary means. It has the advantages of not being limited by environmental conditions, can be detected in various tissues and growth ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor 李斯深蒲艳艳
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More