Molecular marker closely linked with major quantitative trait locus (QTL) of thousand-grain weight and grain length of wheat and obtaining method and application of molecular marker
A technology of molecular markers and acquisition methods, which is applied in the fields of biochemical equipment and methods, recombinant DNA technology, and microbial determination/inspection, etc., can solve the problem of no molecular markers, and achieve rapid and accurate screening, production cost savings, and selection goals. clear effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] A molecular marker closely linked to major QTLs for thousand-grain weight and grain length in wheat,
[0035] labeled primers wmc386 ,
[0036] The left end primer sequence ATCACTGAAACGAAATGAGCGG (as described in SEQ ID NO: 1)
[0037] Right end primer sequence TGGTTGGCGGTTTTTCTCTACA (as described in SEQ ID NO: 2)
[0038] and labeled primer barc216,
[0039] Left end primer sequence TGACGACCCAATCCATAGACA (as described in SEQ ID NO:3)
[0040] Right end primer sequence GGTGATTATTCGTGAGTTCCCTGTG (as described in SEQ ID NO:4)
[0041] The DNA of wheat line Shannong 0431 was amplified by PCR, and the PCR amplification system was 20 μl, H 2 O 5.75 μl, 10×PCR buffer 10.0 μl, Taq enzyme 0.25 μl, left and right end primers 2.0 μl, DNA 2.0 μl; amplification conditions were pre-denaturation at 94°C for 4 min; denaturation at 94°C for 40 s, annealing at 55°C for 45 s, Extend at 72°C for 50 s, 35 cycles; extend at 72°C for 10 min; store at 10°C; the model of the PCR machine ...
Embodiment 2
[0056] The molecular markers closely linked to the major QTLs of wheat thousand-grain weight and grain length provided by the present invention were tested in the F family of wheat line Shannong 0431. 7 Application of 18 derived lines in generation RIL population and Lumai 21
[0057] Using Shannong 0431, a line with large grains, disease resistance, and resistance to dry and hot wind, as the female parent, and Lumai 21, a small-grained, multi-eared variety, as the male parent, F 7 The recombinant inbred line population (RIL population) was used to map the QTL for grain-yield-related traits and screen for molecular markers closely linked to the main QTL. The specific steps are as follows:
[0058] (1) 18 derived strains from the RIL population of the wheat variety Shannong 0431 were planted in the field, and the leaves of the plants of each strain were separated and extracted using the improved CTAB method;
[0059] The derivative varieties or strains of the wheat line Shann...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
