Nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and detection method thereof

A molecular beacon probe and nucleic acid aptamer technology, which can be used in recombinant DNA technology, material excitation analysis, DNA/RNA fragments, etc. problems, to achieve rapid detection and quantitative analysis, good affinity, and simple preparation.

Active Publication Date: 2013-06-12
HUNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two types of probes are subject to certain limitations in application.
Histidine tag antibody is expensive to prepare, takes a long time to detect and lacks accurate quantitative ability
Metal ion probes are inexpensive compared to antibody detection probes, but are also time consuming and lack accurate quantitation capabilities
Most importantly, neither method can directly detect and quantify histidine-tagged proteins in cell lysates

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and detection method thereof
  • Nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and detection method thereof
  • Nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment example 1

[0033] Implementation Case 1: Preparation of Nucleic Aptamer Molecular Beacon Probes

[0034] a kind of like figure 1 The shown nucleic acid aptamer molecular beacon probe of the present invention for detecting histidine tags, the probe includes a nucleic acid aptamer molecular beacon probe and a fluorescent group and a quencher group connected to the 5-terminal and 3-terminal respectively . Nucleic acid aptamer molecular beacon probe includes a histidine tag recognition sequence (5’- CAGGTTG GTCTGGTTGGGTTTGGCTCCTGTGTACG 3'), a nucleic acid fragment cDNA connected to the 3-terminus and partially complementary to the nucleic acid aptamer ( CAACCTG) And the bridge molecule PEG36 connecting two nucleic acid fragments. The ability of double-strand complementary hybridization in the nucleic acid aptamer molecular beacon probe is weaker than the ability of the nucleic acid aptamer to bind to the histidine tag. In this implementation case, the nucleic acid aptamer molecula...

Embodiment 2

[0035] Example 2: Kinetic response of nucleic acid aptamer molecular beacon probes to histidine-tagged proteins

[0036] A nanomolar amount of the substance was dissolved in microliters of binding buffer solution to a final concentration of 25 nanomolar. Two tubes of 200 microliters of the solution were heated at 95°C for 10 minutes, and then slowly cooled to room temperature. Add histidine-tagged P78 recombinant protein or P78 protein to make the final protein concentration 300 nmol. At the same time, the fluorescence change of the nucleic acid aptamer molecular probe was recorded by a Fluorolog spectrophotometer (Jobin Yvon Horiba). Experimental results such as figure 2 As shown, after adding the histidine-tagged P78 protein with a final concentration of 300 nanomolar for 400 seconds, the fluorescence of the nucleic acid aptamer molecular beacon probe increased sharply and continued to increase with time; while the final concentration of 300 nanomolar The P78 protein wit...

Embodiment 3

[0037] Example 3: Specific recognition of various histidine-tagged proteins by nucleic acid aptamer molecular beacon probes

[0038] A nanomolar amount of the substance was dissolved in microliters of binding buffer solution to a final concentration of 25 nanomolar. Take 200 microliters of the solution and heat it at 95°C for 10 minutes, then slowly cool to room temperature. The fluorescence intensity of the nucleic acid aptamer molecular beacon probe was recorded by a Fluorolog spectrophotometer (Jobin Yvon Horiba) at room temperature. Add P68 recombinant protein containing histidine tag (final concentration: 200 nmol), P78 recombinant protein containing histidine tag (final concentration: 200 nmol) and containing Histidine-tagged GSTZ recombinant protein (final concentration: 200 nanomolar), histidine-tagged polypeptide (final concentration: 10 micromolar), P68 protein (final concentration: 200 nanomolar), P78 protein (final concentration: 200 nanomolar) molar), bovine s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer molecular beacon probe for detecting histidine-tag recombinant proteins and a direct general method for detecting the histidine-tag recombinant proteins in cell lysates by the probe. The nucleic acid aptamer probe comprises sequences shown in SEQIDNO.1 and SEQIDNO.2; the end 3' of the sequence shown in the SEQIDNO.1 is bridged with the end 5' of the sequence shown in the SEQIDNO.2 through PEG36; the end 5' of the sequence shown in the SEQIDNO.1 is modified with fluorescein FAM; and the end 3' of the sequence shown in the SEQIDNO.2 is modified with a quenching group Dabcy1. According to the nucleic acid aptamer molecular beacon probe, the expression of the histidine-tag recombinant proteins in the cell lysates can be quickly and quantificationally analyzed without protein tagging, and the method disclosed by the invention has the advantages of universality and low cost, and the advantage that the histidine-tag recombinant proteins can be simply, quickly and quantificationally analyzed.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer molecular beacon probe for detecting histidine-tagged recombinant proteins and a method for detecting histidine-tagged recombinant proteins using the probe. Background technique [0002] Protein expression systems and their recombinant proteins have been widely used in various disciplines of life sciences, and have become powerful research methods and tools in biology. However, the process of isolating and purifying recombinant proteins from protist sources is complex and time-consuming. To simplify this process, a variety of protein affinity tags, such as chitin-binding protein, maltose-binding protein, glutathione-S-transferase, and polyhistidine tags, are widely used for recombinant protein isolation and purification . The most commonly used of these is the addition of a histidine tag of six histidine residues to the N- or C-terminus of the rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12Q1/68G01N21/64
Inventor谭蔚泓张晓兵谭晓红丁玎
OwnerHUNAN UNIV