Fusion protein capable of activating tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in targeted mode, recombinant vector and application of recombinant vector
A technology for recombining vectors and signaling pathways, applied in applications, recombinant DNA technology, DNA/RNA fragments, etc., can solve problems such as side effects and lethality, and achieve the effect of avoiding side effects and great commercial value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] (1) Preparation of recombinant vector pENTR-2B-Gyrase B-HA
[0040] ① Obtain the Gyrase B gene by PCR reaction, and the primers (both 5'-3', synthesized by BGI) are as follows:
[0041] FP: ATCGGAATTCATGTCGAACTCTTTATGACTCCTCC;
[0042] RP: ATCCACTAGTTTAAGCGTAATCTGGAACATCGTATGGGTAGCCTTCATAGTGGAAGTGGTCTTC.
[0043] Mix the PCR reaction solution according to the following system:
[0044]
[0045]
[0046] The PCR reaction was performed according to the following procedures: initial denaturation at 94°C for 2 min; denaturation at 94°C for 15 sec, refolding at 55°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; 72°C for 10 min.
[0047] ② Add 2.5 times the volume of frozen absolute ethanol to the PCR product obtained in step ① (add 0.1 times the volume of 3M sodium acetate at pH 5.6 at the same time) to precipitate, and the precipitate is formulated according to the following reaction system:
[0048] PCR precipitate
[0049]
[0050] The above reaction s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
