Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method of single nucleotide polymorphism and molecular markers of cattle FBXO32 genes

A technology of single nucleotide polymorphism and molecular marker, applied in the field of molecular genetics

Inactive Publication Date: 2012-12-12
NORTHWEST A & F UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research on the genetic variation of bovine FBXO32 gene at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of single nucleotide polymorphism and molecular markers of cattle FBXO32 genes
  • Detection method of single nucleotide polymorphism and molecular markers of cattle FBXO32 genes
  • Detection method of single nucleotide polymorphism and molecular markers of cattle FBXO32 genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] The present invention utilizes PCR-RFLP and ACRS-PCR-RFLP method to yellow cattle FBXO32

[0029] The single nucleotide polymorphisms of the 22830th, 44675th and 53423rd genes were detected

[0030] Measurement and correlation analysis, the present invention will be described in further detail below, described is to the present invention

[0031] explanation rather than limitation.

[0032] a. PCR of cattle FBXO32 gene containing exon 3, intron 8 and intron 10

[0033] Primer design

[0034] Taking the bovine sequence published by NCBI (NC_007312.4) as a reference, using Primer 5.0

[0035] The design can amplify the exon 3, intron 8 and intron 8 of the cattle FBXO32 gene respectively.

[0036] PCR primers for intron 10.

[0037] The primers for amplifying exon 3 are:

[0038] Upstream primer: 5′CGACCCTTCTACCGTGCGTTCC 3′

[0039] Downstream primer: 5′GGGCTCCCTCCTCACCCTGTT 3′

[0040] The primers for amplifying the 8th intron are:

[0041] Upstream primer: 5′GGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method of single nucleotide polymorphism and molecular markers of cattle FBXO32 genes. Cattle full genome deoxyribonucleic acid (DNA) to be detected comprises FBXO32 genes and serves as a template. A primer pair P (P1, P2 and P3) serves as a primer. Cattle FBXO32 genes are amplified through polymerase chain reaction (PCR). PCR amplification products are digested by restriction endonuclease HaeIII, HaeIII and BfaI respectively, agarose gel electrophoresis is performed on amplification segments after enzyme digestion, and single nucleotide polymorphism at 22830 position, 44675 position and 53423 position of the cattle FBXO32 genes (national center of biotechnology information (NCBI) reference serial number: NC:_007312.4) is identified according to agarose gel electrophoresis results. The detection method lays a base for establishment of the relationship between the single nucleotide polymorphism and growth trait of the FBXO32 genes, can be used for marker assisted selection (MAS) of the growth trait for Chinese cattle conveniently, and establishes cattle population with good genetic resources rapidly.

Description

technical field [0001] The invention belongs to the field of molecular genetics, relates to the detection of gene single nucleotide polymorphism (SNP), in particular to a method for detecting the single nucleotide polymorphism of cattle FBXO32 gene. Background technique [0002] Single nucleotide polymorphism (SNP) mainly refers to the DNA sequence polymorphism caused by a single nucleotide variation at the genome level. SNPs may be within the gene sequence or on non-coding sequences outside the gene. In general, SNPs (coding SNPs, cSNPs) located in the coding region are relatively small, because the variation rate in exons is only 1 / 5 of that of the surrounding sequences. However, it is of great significance in the study of genetic diseases, so the study of cSNP has attracted more attention. However, with the development of science, many studies have shown that the SNP located in the gene intron will affect the transcription efficiency of the gene and indirectly affect th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 陈宏王爱兰蓝贤勇
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com