Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof
A programmed death and fusion protein technology, which is applied in the field of calreticulin-soluble programmed death receptor 1 fusion protein and its preparation and application, can solve the problems of not having tumor immunogenicity, etc., and achieve prolonged survival, growth inhibitory effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0045] The present invention will be described in detail through specific examples below.
[0046] This invention comprises the following steps successively:
[0047] 1. Construction and identification of recombinant eukaryotic expression plasmids
[0048] pcDNA3.1(+) / CRT Δ , pcDNA3.1(+) / sPD1 and pcDNA3.1(+) / CRT ⊿ - Construction of sPD1 eukaryotic expression plasmid
[0049] The target fragments of mCRT and mPD1 were obtained by PCR cloning using the cDNA of mouse lymphocytes as a template, and HindⅢ and XhoI restriction enzyme sites were introduced at the 5' ends of the upstream primer and downstream primer, respectively, to facilitate subsequent cloning operations. The PCR primers were designed as follows:
[0050] mCRT upstream primers:
[0051] GTCGAAGCTTAACCATGCTCCTTTCGGTGCCGCTC
[0052] Downstream primers:
[0053] CAAGCTCGAGTTAATGATGATGATGATGATGACCCCCTTCTGGGTGTATCCAGGTAC
[0054] mPD1 upstream primer:
[0055] CAGTAAGCTTATGTGGGTCCGGCAGGTAC
[0056] Downstream ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com