Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof

A programmed death and fusion protein technology, which is applied in the field of calreticulin-soluble programmed death receptor 1 fusion protein and its preparation and application, can solve the problems of not having tumor immunogenicity, etc., and achieve prolonged survival, growth inhibitory effect

Inactive Publication Date: 2013-01-30
CHINA THREE GORGES UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most antitumor drugs can induce tumor cell apoptosis but cannot cause membrane translocation and clustering of CRT, and such apoptotic tumor cells do not have tumor immunogenicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof
  • Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof
  • Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0045] The present invention will be described in detail through specific examples below.

[0046] This invention comprises the following steps successively:

[0047] 1. Construction and identification of recombinant eukaryotic expression plasmids

[0048] pcDNA3.1(+) / CRT Δ , pcDNA3.1(+) / sPD1 and pcDNA3.1(+) / CRT ⊿ - Construction of sPD1 eukaryotic expression plasmid

[0049] The target fragments of mCRT and mPD1 were obtained by PCR cloning using the cDNA of mouse lymphocytes as a template, and HindⅢ and XhoI restriction enzyme sites were introduced at the 5' ends of the upstream primer and downstream primer, respectively, to facilitate subsequent cloning operations. The PCR primers were designed as follows:

[0050] mCRT upstream primers:

[0051] GTCGAAGCTTAACCATGCTCCTTTCGGTGCCGCTC

[0052] Downstream primers:

[0053] CAAGCTCGAGTTAATGATGATGATGATGATGACCCCCTTCTGGGTGTATCCAGGTAC

[0054] mPD1 upstream primer:

[0055] CAGTAAGCTTATGTGGGTCCGGCAGGTAC

[0056] Downstream ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a calreticulin-soluble programmed death receptor 1 fusion protein, and a preparation method and a purpose thereof. The invention provides a fusion protein CRTdelta-sPD1 of a mice C-zone-partially-amputated calreticulin and soluble programmed death receptor 1 extracellular domain; the fusion protein is subjected to eukaryotic expression, such that a cell line stably expressing CRTdelta-sPD1 is established; and the CRTdelta-sPD1 is secreted out of the cells by using secretory peptide. The CRTdelta-sPD1 fusion protein provided by the invention has activities of combining cell surface PD-L1 and promoting lymphocyte proliferation and killing. Also, the CRTdelta-sPD1 fusion protein can be activated in vivo, and can induce an immune system to perform specific killing against tumors. Therefore, tumor growth is inhibited, and tumor mice survival time is prolonged. The CRTdelta-sPD1 fusion protein can be adopted as a tumor immunotherapy medicine candidate, and can be used for treating diseases such as tumors.

Description

technical field [0001] The invention relates to the field of DNA recombination technology and protein medicine, belongs to the field of medical biotechnology, and specifically relates to a calreticulin-programmed death receptor 1 fusion protein, a DNA sequence encoding the fusion protein, a vector or a plasmid, and a host containing the DNA sequence A cell, a method for preparing the fusion protein by genetic engineering, and the application of the fusion protein in diseases such as tumors. Background technique [0002] Calreticulin (CRT) is a highly conserved calcium-binding protein that belongs to the heat shock protein family. It mainly exists in the endoplasmic reticulum and has various biological functions. Immunogenic apoptosis mediated by CRT plays an important role in anti-tumor immunity. Studies have found that certain anti-tumor treatments can induce the rapid translocation of CRT from the intracellular to the membrane surface and cluster on the cell membrane, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10A61K38/17A61K48/00A61P35/00A61P37/02
Inventor 刘朝奇
Owner CHINA THREE GORGES UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com