Unlock instant, AI-driven research and patent intelligence for your innovation.

Proteins related to plant spike shape and their coding genes and applications

A plant, transgenic plant technology, applied in the direction of plant genetic improvement, application, plant peptides, etc., can solve the problem of unexplainable pedicels and so on

Inactive Publication Date: 2014-10-08
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, the molecular biological mechanism controlling the occurrence and development of rice cobs, primary and secondary branches has been relatively clear; for the development of pedicels, LAX1 can only explain the pedicel origin of lateral panicles (OikawaT and Kyozuka J(2009)Two -Step Regulation of LAX PANICLE1 Protein Accumulation in Axillary Meristem Formation in Rice.PLANT CELL 21(4):1095-1108), the differentiation information of panicle meristem controlled by FZP gene contains all flower stalk development information (Komatsu M, Maekawa M, Shimamoto K, and Kyozuka J (2001) The LAX1 and FRIZZY PANICLE 2 Genes Determine the Inflorescence Architecture of Rice by Controlling Rachis-Branch and Spikelet Development. Developmental Biology 23: 364-373), but none of these genes can explain the formation of flower stalks due to shortened length A mutant of rice-clustered panicle mutant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Proteins related to plant spike shape and their coding genes and applications
  • Proteins related to plant spike shape and their coding genes and applications
  • Proteins related to plant spike shape and their coding genes and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Obtainment of SPEDJ gene related to rice panicle shape

[0042] 1. SPED mutant traits

[0043] Under natural conditions in summer, the SPED mutant has no abnormal vegetative growth status, but the ear morphology has changed mainly in two aspects: First, from the perspective of the spikelet implantation state, the grains originally distributed in steps on the first and second branches. The grains (spikelets) form a cluster at the top part, usually 3 to 5 grains grow in clusters, and the spikelets on the first and second branches counting from the top to the bottom 3 to 5 grains are still at a certain shaved distance Born on branch stems; second, from the perspective of terminal branch characteristics, all pedicels directly connected to spikelets are extremely shortened to about 1.0 mm, and each level of peduncle is shortened from 1 to 3 nodes from top to bottom, of which shortened 1 node of peduncle showed 3 clusters of spikelets, 2 nodes shortened to 4 clusters, ...

Embodiment 2

[0059] Example 2. Panicle shape analysis of plants with SPEDJ gene

[0060] 1. Panicle shape analysis of SPEDJ transgenic rice plants

[0061] Design primers based on the SPEDJ gene amplified in Example 1, and add BamHI and SalI restriction sites. The primer sequence is as follows:

[0062] SPEDJ-F: GG GGATCC GAAGCAATTCCATGCAATGAGG (underlined is the BamHI restriction site) (sequence 4 in the sequence table),

[0063] SPEDJ-R: GT GTCGAC GGTCCAGTCAAACTAATGG (the underline is the SalI restriction site) (sequence 5 in the sequence table),

[0064] Using SPEDJ-F and SPEDJ-R as primers, using SPED mutant leaf genomic DNA as a template, PCR amplification was performed to obtain a 455bp amplified product, the nucleotide sequence of which is shown in sequence 3 in the sequence table. Add BamHI and SalI restriction sites at both ends of the sequence. The product was digested with BamHI and SalI, and then ligated to the expression vector pZH01 (the public can obtain it from the Institute of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protein relevant to a plant spike shape and an encoding gene and appliance of the protein relevant to the plant spike shape. The protein relevant to the plant spike shape is the protein of a following (a) or the protein of a following (b). The protein provided in (a) is composed of an amino acid sequence shown in a sequence 1 in a sequence table; and the protein of a following (b) is relevant to the plant spike shape and is derived through the protein in (a) by displacing and / or deleting and / or adding one or a plurality of amino acid residues of the amino acid sequence shown in the sequence 1 in the sequence table. Due to the cloning of an SPEDJ gene, rice spike morphogenesis, especially a development problem of a tail end branch is further looked into, a determinant of transporting biological substance from a source to a bank is explored, a deep theoretical problem of 'ideal stripe shape' is finally solved, and the protein relevant to the plant spike shape and the encoding gene and appliance of the protein relevant to the plant spike shape are hopeful to be taken as a guide new direction of crop high-yield breeding.

Description

Technical field [0001] The invention relates to a protein related to the shape of plant ears and its coding genes and applications. Background technique [0002] In the grass family, the main axis of the inflorescence is called rachis (Bell, AD (1991) Plant Form: An Illustrated Guide to Flowering Plant Morphology, Oxford University Press, New York. p. 184-191.), born in The lateral branches on the cob are called the first-level branches, and in this way, the lower-level branches that are born on the first-level branches are called the second-level branches. The professional name "branch" is only used when the inflorescence branch has a structure with sufficient length to support more than one spikelet. When the branch is short enough to contain only one spikelet (at least one flower and its connected stalk), it can only It is called peduncle (Ikeda, K, Sunohara H and Nagato Y (2004) Development Course of Inflorescence and Spikelet in Rice.Breed.Sci.54: 147-156), and it is even s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A01H5/00
Inventor 翟文学江光怀向阳海
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI