Proteins related to plant spike shape and their coding genes and applications
A plant, transgenic plant technology, applied in the direction of plant genetic improvement, application, plant peptides, etc., can solve the problem of unexplainable pedicels and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1. Obtainment of SPEDJ gene related to rice panicle shape
[0042] 1. SPED mutant traits
[0043] Under natural conditions in summer, the SPED mutant has no abnormal vegetative growth status, but the ear morphology has changed mainly in two aspects: First, from the perspective of the spikelet implantation state, the grains originally distributed in steps on the first and second branches. The grains (spikelets) form a cluster at the top part, usually 3 to 5 grains grow in clusters, and the spikelets on the first and second branches counting from the top to the bottom 3 to 5 grains are still at a certain shaved distance Born on branch stems; second, from the perspective of terminal branch characteristics, all pedicels directly connected to spikelets are extremely shortened to about 1.0 mm, and each level of peduncle is shortened from 1 to 3 nodes from top to bottom, of which shortened 1 node of peduncle showed 3 clusters of spikelets, 2 nodes shortened to 4 clusters, ...
Embodiment 2
[0059] Example 2. Panicle shape analysis of plants with SPEDJ gene
[0060] 1. Panicle shape analysis of SPEDJ transgenic rice plants
[0061] Design primers based on the SPEDJ gene amplified in Example 1, and add BamHI and SalI restriction sites. The primer sequence is as follows:
[0062] SPEDJ-F: GG GGATCC GAAGCAATTCCATGCAATGAGG (underlined is the BamHI restriction site) (sequence 4 in the sequence table),
[0063] SPEDJ-R: GT GTCGAC GGTCCAGTCAAACTAATGG (the underline is the SalI restriction site) (sequence 5 in the sequence table),
[0064] Using SPEDJ-F and SPEDJ-R as primers, using SPED mutant leaf genomic DNA as a template, PCR amplification was performed to obtain a 455bp amplified product, the nucleotide sequence of which is shown in sequence 3 in the sequence table. Add BamHI and SalI restriction sites at both ends of the sequence. The product was digested with BamHI and SalI, and then ligated to the expression vector pZH01 (the public can obtain it from the Institute of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 