Unlock instant, AI-driven research and patent intelligence for your innovation.

Plant peduncle development related protein, and coding gene and application thereof

A technology for encoding genes and proteins, applied in plant genetic improvement, angiosperms/flowering plants, applications, etc., can solve problems such as inability to explain flower stalks

Inactive Publication Date: 2014-09-10
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, the molecular biological mechanism controlling the occurrence and development of rice cobs, primary and secondary branches has been relatively clear; for the development of pedicels, LAX1 can only explain the pedicel origin of lateral panicles (Oikawa T and Kyozuka J(2009) Two-Step Regulation of LAX PANICLE1Protein Accumulation in Axillary Meristem Formation in Rice.PLANT CELL21(4):1095–1108), the differentiation information of panicle meristem controlled by FZP gene contains all flower stalk development information (Komatsu M, Maekawa M, Shimamoto K, and Kyozuka J (2001) The LAX1 and FRIZZY PANICLE2 Genes Determine the Inflorescence Architecture of Rice by Controlling Rachis-Branch and Spikelet Development. Developmental Biology 23:364–373), but none of these genes can account for the fact that the flower stalk is shortened in length Seed rice mutants-clustered panicle mutants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant peduncle development related protein, and coding gene and application thereof
  • Plant peduncle development related protein, and coding gene and application thereof
  • Plant peduncle development related protein, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, the acquisition of the sped1-D gene related to rice panicle shape

[0039] 1. Traits of sped1-D mutant

[0040] Under the natural conditions in summer, the vegetative growth state of the sped1-D mutant is normal, but the panicle morphology changes, mainly in two aspects: one is that from the point of view of the growth state of the spikelet, it was originally distributed in a cascade on the first and second branches The grains (spikelets) on the top part are clustered together, usually 3 to 5 grains are clustered, and the spikelets on the first and second branches are still shaved according to the 3 to 5 grains below the top. The distance grows on the branches; secondly, from the perspective of the characteristics of the terminal branches, all the peduncles directly connected to the spikelets are extremely shortened to about 1.0 mm, and each level of peduncle has 1 to 3 nodes shortened from top to bottom. Among them, 1 shortened peduncle shows clusters of...

Embodiment 2

[0057] Embodiment 2, the spike shape analysis of transgenic rice plant of sped1-D

[0058] Design primers according to the sped1-D gene amplified in the above-mentioned embodiment 1, add EcoRI and HindIII restriction sites, and the primer sequences are as follows:

[0059] sped1-D-F: GC GAATTC GGCTGACCTCAGCTTGAGTT (the underline is the EcoRI site) (sequence 3 in the sequence listing),

[0060] sped1-D-R: GC AAGCTT GTTGGTCCAGTCAAACTAATG (the underline is the HindIII site) (sequence 4 in the sequence listing),

[0061] Using the sped1-D gene shown in Sequence 2 in the artificially synthesized sequence listing as a template, perform PCR amplification to obtain a full-length double-stranded cDNA product of 1176bp sped1-D gene, and add EcoRI at both ends of the gene sequence and HindIII restriction sites. After the product was double-digested with EcoRI and HindIII, it was connected between the EcoRI and HindIII restriction sites of the expression vector pCAMBIA1301 (purchase...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant peduncle development related protein, and a coding gene and application thereof. The plant peduncle development related protein disclosed by the invention is the following protein (a) or (b): (a) protein composed of amino acid sequence disclosed as Sequence 1 in the sequence table; or (b) plant peduncle development related (a)-derived protein subjected to substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid residue sequence disclosed as Sequence 1 in the sequence table. By cloning the sped1-D gene, the problems of rice ear morphogenesis and especially the development of tail end rachis branch are deeply learned, and the source-to-library transmission determinant of biological substances is searched to finally solve the deep theoretical problem of ideal plant shape; and the protein is hopeful to lead the high crop yield to new directions.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a protein related to the development of a plant pedicel and its coding gene and application. Background technique [0002] In Poaceae, the main axis of the inflorescence is called rachis (Bell, AD (1991) Plant Form: An Illustrated Guide to Flowering Plant Morphology, Oxford University Press, New York. p.184-191.), Physiological The lateral branches on the cob are called first-level branches, and by analogy, the lower-level branches born on the first-level branches are called second-level branches. The technical name "branch" is used only for structures where inflorescence branches are of sufficient length to support more than one spikelet. Known as the peduncle (Ikeda, K, Sunohara H and Nagato Y (2004) Development Course of Inflorescence and Spikelet in Rice. Breed. Sci. 54:147–156), and shorter to contain only one floret When it grows, it is called a pedicel. [0003] The develop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/11A01H5/00
CPCC07K14/415C12N15/827
Inventor 翟文学江光怀向阳海
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI