Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Protein relevant to plant spike shape and encoding gene and appliance thereof

A spike-shaped, transgenic rice technology, applied in the direction of plant gene improvement, application, plant peptides, etc., can solve the problem of unexplainable flower stalks

Inactive Publication Date: 2014-07-30
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In particular, the molecular biological mechanism controlling the occurrence and development of rice cobs, primary and secondary branches has been relatively clear; for the development of pedicels, LAX1 can only explain the pedicel origin of lateral panicles (Oikawa T and Kyozuka J(2009) Two-Step Regulation of LAX PANICLE 1Protein Accumulation in Axillary Meristem Formation in Rice.PLANT CELL 21 (4): 1095-1108), the differentiation information of panicle meristem controlled by FZP gene contains all flower stalk development information (Komatsu M, Maekawa M, Shimamoto K, and Kyozuka J (2001) The LAX1 and FRIZZY PANICLE 2 Genes Determine the Inflorescence Architecture of Rice by Controlling Rachis-Branch and Spikelet Development. Developmental Biology 23:364-373), but none of these genes could explain the flower peduncle because A Rice Mutant Formed by Shortened Length--Clustered Panic Mutant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein relevant to plant spike shape and encoding gene and appliance thereof
  • Protein relevant to plant spike shape and encoding gene and appliance thereof
  • Protein relevant to plant spike shape and encoding gene and appliance thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, the acquisition of the SPED gene relevant to rice panicle shape

[0039] 1. SPED mutant traits

[0040] Under the natural conditions in summer, the vegetative growth state of the SPED mutant was normal, but the panicle morphology changed, mainly in two aspects: first, from the point of view of the spikelet growth state, the grains that were originally distributed on the first and second branches in a cascade Grains (spikelets), clustered at the top part, generally 3 to 5 clusters, and the spikelets on the first and second branches counting from the top down to 3 to 5 grains are still at a certain distance It grows on the branches; secondly, judging from the characteristics of the terminal branches, all the peduncles directly connected to the spikelets are extremely shortened to about 1.0 mm, and each level of peduncle has 1 to 3 shortened nodes from top to bottom, among which the shortened The 1-node peduncle shows clusters of spikelets with 3 grains, the...

Embodiment 2

[0057] Embodiment 2, the ear shape analysis of transgenic rice plant of SPED

[0058] According to the SPED gene design primer that amplifies above-mentioned embodiment 1, add EcoRI and HindIII restriction site, primer sequence is as follows:

[0059] SPED-F: GC GAATTC GGCTGACCTCAGCTTGAGTT (the underline is the EcoRI site) (sequence 3 in the sequence listing),

[0060] SPED-R: GC AAGCTT GTTGGTCCAGTCAAACTAATG (the underline is the HindIII site) (sequence 4 in the sequence listing),

[0061] Using the artificially synthesized SPED gene shown in Sequence 2 in the sequence listing as a template, carry out PCR amplification to obtain the full-length double-stranded cDNA product of the 1176bp SPED gene, and add EcoRI and HindIII restriction enzymes to both ends of the gene sequence site. After the product was double-digested with EcoRI and HindIII, it was connected between the EcoRI and HindIII restriction sites of the expression vector pCAMBIA1301 (purchased from CAMBIA Compa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protein relevant to a plant spike shape and an encoding gene and appliance of the protein relevant to the plant spike shape. The protein relevant to the plant spike shape is the protein of a following (a) or the protein of a following (b). The protein of the following (a) is composed of an amino acid sequence shown in a sequence 1 in a sequence table; and the protein of the following (b) is relevant to the plant spike shape and is derived through the protein in (a) by displacing and / or deleting and / or adding one or a plurality of amino acid residues of the amino acid sequence shown in the sequence 1 in the sequence table. Due to the cloning of an SPEDJ gene, rice spike morphogenesis, especially a development problem of a tail end branch is further looked into, a determinant of transporting biological substance from a source to a bank is explored, a deep theoretical problem of 'ideal stripe shape' is finally solved, and the protein relevant to the plant spike shape and the encoding gene and appliance of the protein relevant to the plant spike shape are hopeful to be taken as a guide new direction of crop high-yield breeding.

Description

technical field [0001] The invention relates to a protein related to plant spike shape, its coding gene and application. Background technique [0002] In Poaceae, the main axis of the inflorescence is called rachis (Bell, AD (1991) Plant Form: An Illustrated Guide to Flowering Plant Morphology, Oxford University Press, New York. p.184-191.), Physiological The lateral branches on the cob are called first-level branches, and by analogy, the lower-level branches born on the first-level branches are called second-level branches. The technical name "branch" is used only for structures where inflorescence branches are of sufficient length to support more than one spikelet. Known as the peduncle (Ikeda, K, Sunohara H and Nagato Y (2004) Development Course of Inflorescence and Spikelet in Rice. Breed. Sci. 54:147-156), and is even shorter to contain only a single floret When it grows, it is called a pedicel. [0003] The growth and development of rice inflorescences, especially b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A01H5/00
Inventor 翟文学江光怀向阳海
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com