Protein relevant to plant spike shape and encoding gene and appliance thereof
A spike-shaped, transgenic rice technology, applied in the direction of plant gene improvement, application, plant peptides, etc., can solve the problem of unexplainable flower stalks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, the acquisition of the SPED gene relevant to rice panicle shape
[0039] 1. SPED mutant traits
[0040] Under the natural conditions in summer, the vegetative growth state of the SPED mutant was normal, but the panicle morphology changed, mainly in two aspects: first, from the point of view of the spikelet growth state, the grains that were originally distributed on the first and second branches in a cascade Grains (spikelets), clustered at the top part, generally 3 to 5 clusters, and the spikelets on the first and second branches counting from the top down to 3 to 5 grains are still at a certain distance It grows on the branches; secondly, judging from the characteristics of the terminal branches, all the peduncles directly connected to the spikelets are extremely shortened to about 1.0 mm, and each level of peduncle has 1 to 3 shortened nodes from top to bottom, among which the shortened The 1-node peduncle shows clusters of spikelets with 3 grains, the...
Embodiment 2
[0057] Embodiment 2, the ear shape analysis of transgenic rice plant of SPED
[0058] According to the SPED gene design primer that amplifies above-mentioned embodiment 1, add EcoRI and HindIII restriction site, primer sequence is as follows:
[0059] SPED-F: GC GAATTC GGCTGACCTCAGCTTGAGTT (the underline is the EcoRI site) (sequence 3 in the sequence listing),
[0060] SPED-R: GC AAGCTT GTTGGTCCAGTCAAACTAATG (the underline is the HindIII site) (sequence 4 in the sequence listing),
[0061] Using the artificially synthesized SPED gene shown in Sequence 2 in the sequence listing as a template, carry out PCR amplification to obtain the full-length double-stranded cDNA product of the 1176bp SPED gene, and add EcoRI and HindIII restriction enzymes to both ends of the gene sequence site. After the product was double-digested with EcoRI and HindIII, it was connected between the EcoRI and HindIII restriction sites of the expression vector pCAMBIA1301 (purchased from CAMBIA Compa...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com