Anti-burn and scald infection multiple organ failure Pseudomonas aeruginosa toxin vaccine

A Mycobacterium tuberculosis and gene technology, applied in the direction of antibacterial drugs, bacterial antigen components, antibody medical components, etc., can solve problems such as easy to cause allergic reactions, failure to metabolize in time, serious adverse reactions, etc., and achieve the goal of eliminating multiple organ failure syndrome occurrence, improving treatment efforts, and improving the effect of rehabilitation

Inactive Publication Date: 2013-06-12
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Freund's adjuvant is an oil-containing adjuvant and is currently the most widely used experimental adjuvant. Its advantage is that it has a strong immune enhancement effect, including cellular immunity and humoral immunity. Although this type of adjuvant can improve antibody titer In terms of amplitude and immune persistence,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-burn and scald infection multiple organ failure Pseudomonas aeruginosa toxin vaccine
  • Anti-burn and scald infection multiple organ failure Pseudomonas aeruginosa toxin vaccine
  • Anti-burn and scald infection multiple organ failure Pseudomonas aeruginosa toxin vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: PEA I Region gene amplification and correlation with pET28a- HSP65 connect

[0052] The primers for the HSP65 fragment were designed, and each primer contained NcoI and EcoRI restriction sites (underlined parts) and protective bases respectively. The primers of PEAⅠarea were synthesized and the recognition sites of EcoRI and HindⅢ endonucleases were respectively designed to amplify the gene fragments of PEAⅠregion.

[0053] Fh: 5`GC CCATGG ATGGCCAAGACAATTGCGTACGA3`, TM=68 containing NcoⅠ;

[0054] Rh: 5`AC GAATTC TTAGCTAGCCATATGGAAATCCATGC3`, TM=68 with EcoRI.

[0055] Fp: 5`CG GAATTC CTGGTCGCCAGCCTCGGCC3`, TM=68 with EcoRI;

[0056] Rp: 5`CC CAAGCTT TTAGTCGACCTGGTTCCACGACAG, TM=68 contains HindⅢ;

[0057] Using the complete HSP65 gene sequence (gifted by Professor Wang Liying, Bethune School of Medicine, Jilin University) as a template, the 1600bp target gene sequence was amplified with primers Fh and Rh, and the amplified product and plasmid ...

Embodiment 2

[0060] Example 2: High-density fermentation in a fermenter, large-scale preparation of engineering bacteria using fermentation technology, the yield reached 36.5g / L fermentation broth, the growth of the bacteria reached the best time for induction after 3 hours of inoculation, and the bacteria began to produce alkali after 2 hours of induction , the protein begins to be expressed in large quantities, and put into the tank after 5 hours of induction.

Embodiment 3

[0061] Example 3: Expression, purification, and protein properties of recombinant protein HSP65-PEA

[0062] The recombinant plasmid pET28a- HSP65-PEAⅠ Transformed expression bacteria-Escherichia coli BL21 (DE3), after IPTG-induced expression, SDS-PAGE results showed that there was an obvious expression band of recombinant protein HSP65-PEAⅠ at about 93KD, the size was consistent with the theoretical value, and the expression amount of the fusion protein accounted for 93KD. 33.3% of total protein (see image 3 .

[0063] SDS-PAGE electrophoresis was performed on the lysate supernatant and the precipitate of the recombinant protein expressing bacteria at the same time. The results showed that most of the target protein was in the supernatant, and a small amount of target protein also existed in the corresponding position in the precipitate. Can be expressed in a soluble form in an inducible environment (see Figure 4 ).

[0064] Purification of the fusion protein HSP65-PEAⅠ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fused gene HSP65-PEAI which is a fused gene connected by a gene of mycobacterium tuberculosis heat shock protein 65 and a PEA receptor bonded with a subunit gene. Mice are immunized by the fused protein HSP65-PEAI expressed by the gene without any adjuvants. Toxic substances are counterattacked by 3 times of LD50 dosage PEA, so that the protective rate reaches 100%, while toxic substances are counterattacked by 5 times of LD50 dosage PEA, so that the protective rate reaches over 80%. After three times of immunization of rabbit, a third-degree burn multiple organ failure animal model is manufactured and a Pseudomonas aeruginosa PA103 bacterium is artificially infected. No multiple organ failure symptoms for an immune experiment group occur within 10 days and the rabbits survive completely. The fused protein HSP65-PEAI as the anti-burn and scald infection multiple organ failure Pseudomonas aeruginosa toxin vaccine can be used for wound and scald high risk operators, especially for prevention or emergent immunization of combatants before war to prevent Pseudomonas aeruginosa infection and avoid wound and scald multiple organ failure syndrome and shock, so that the burn and scald rescue rate of survival in the baffle field is increased.

Description

Technical field [0001] The present invention belongs to the field of biological engineering and disease prevention, which specifically involves a fusion protein HSP65-PEA Ⅰ, and the fusion protein HSP65-PEA Ⅰ as the application of vaccine infection, especially the application of multi-organ failure and shock in the prevention of burns and burns infection.Essence Background technique [0002] Burns are one of the important wounds.Different national troops, the war ratio of different opponents, the proportion of burns is very different.The average burn ratio was 6%of the total injured in the first and second World War and the Korean War and the Vietnam War.The third World National Army faced large -scale lethal weapons such as solidifying gasoline bombs and white phosphorus bombs, and the proportion of burns was much higher than the U.S. military, which could reach 16%.Under the conditions of modern high -tech local war, with the large -scale application of high -pressure and high ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/62C12N15/70C07K19/00A61K39/02A61K39/39A61K38/16A61P31/04
Inventor 张国利冯越朱平岳玉环吴广谋田园
Owner MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap