Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene engineering bacterium for efficiently reducing azo dyes, and construction method and application thereof

A technology of genetically engineered bacteria and azo dyes, applied in the field of genetically engineered bacteria and its construction for efficient reduction of azo dyes, can solve problems such as unsatisfactory growth

Inactive Publication Date: 2013-06-12
GUANGDONG INST OF MICROORGANISM
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the growth of S.decolorationis S12 is significantly affected by temperature, and its growth is not ideal at high temperatures such as above 37°C or at low temperatures below 15°C

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering bacterium for efficiently reducing azo dyes, and construction method and application thereof
  • Gene engineering bacterium for efficiently reducing azo dyes, and construction method and application thereof
  • Gene engineering bacterium for efficiently reducing azo dyes, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1: Construction method of genetically engineered bacteria E.coli BL21(DE3) / azoR for efficiently reducing azo dyes

[0019] (1) Primer design;

[0020] According to the riboflavin-dependent NADH-azo reductase of S. decolorationis S12, the open reading frame and upstream promoter of the azoR gene (its Genebank accession number EF198254) (its Genebank accession number EF647586) Sequence, select its upstream and downstream conserved sequences to design upstream primer U and downstream primer D, and add NdeI restriction endonuclease enzyme cutting site sequence at the 5' end of upstream primer U, and add The sequence of the cutting site of the XhoI restriction endonuclease. The base sequences of primers U and D are as follows, and the underlined parts are the restriction site sequences of NdeI and XhoI restriction endonucleases, respectively.

[0021] Upstream primer U: GGAATTC CATATG TCCGCTTTTTTTTCTTTTTTA

[0022] Downstream primer D: CCG CTCGAG AACAGCTAACTTA...

Embodiment 2

[0037] Example 2: Induced expression of azoreductase in genetically engineered bacteria E.coli BL21(DE3) / azoR

[0038] (1) Induction of genetically engineered bacteria

[0039] The genetically engineered bacteria E.coli BL21(DE3) / azoR were inoculated in LB liquid medium and cultured overnight at 37°C in a shaker with a rotation speed of 200rpm / min. Inoculate the overnight culture into fresh LB liquid medium with an inoculum amount of 1.5%, and cultivate it in a shaker at 37°C with a rotation speed of 200rpm / min. 600 When it reaches 0.6, add 0.4mM lactose to induce, and induce at 30°C for 4h.

[0040] (2) Preparation of crude enzyme solution

[0041] Centrifuge the induced bacterial solution at 12,000×g for 10 min, remove the supernatant, and collect the bacterial cells. Wash the bacteria twice with phosphate buffered saline (PBS, pH7.4), and finally resuspend in a certain volume of buffer to make the bacterial solution A 600 About 0.8. The bacterial liquid was crushed for...

Embodiment 3

[0045] Embodiment 3: Enzyme activity comparison of different bacterial strains crude enzyme liquid

[0046] According to Example 2, the crude enzyme solution of genetically engineered bacteria E.coli BL21(DE3) / azoR under induction conditions was prepared. Transform the strains E.coli BL21(DE3) / azoR, E.coli BL21(DE3), E.coli BL21(DE3) / pET-22b(+) into the empty vector pET-22b in E.coli BL21(DE3) (+)) and S.decolorationis S12 were inoculated in LB liquid medium and cultured overnight in a shaker at 37°C (30°C for S.decolorationis S12) with a rotation speed of 200rpm / min. The overnight culture was inoculated into fresh LB liquid medium at an inoculum volume of 1.5%, and cultured in a shaker at 37°C (30°C for S. decolorationis S12) at a speed of 200rpm / min until the genetically engineered bacteria induced expression The time required for cultivation (in bacterial solution A 600 reached 0.6), and then prepare the crude enzyme solution.

[0047] The enzyme activity assay was carri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
absorption wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene engineering bacterium for efficiently reducing azo dyes, and a construction method and application thereof. An NADH-azo reductase gene and a forward promoter sequence thereof are connected with an expression vector pET-22b(+), and transformed into Escherichia coli E.coli BL21(DE3) to obtain the gene engineering bacterium E.coli BL21(DE3) / azoR with double promoters for efficiently reducing azo dyes. The NADH-azo reductase gene is disclosed as a nucleotide sequence of which the Genebank registration number is EF198254, and the forward promoter of the NADH-azo reductase gene is disclosed as a nucleotide sequence of which the Genebank registration number is EF647586. The gene engineering bacterium E.coli BL21(DE3) / azoR can implement decolorization of azo dyes within wider temperature range, has higher decolorizing active and long-term survival capacity, and has wider application prospects in dye wastewater treatment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a genetic engineering bacterium for efficiently reducing azo dyes and its construction method and application. Background technique: [0002] In recent years, with the widespread use of azo dyes, the environmental pollution problems caused by the "three causes" caused by the synthesis and degradation process have become increasingly serious, and the research on the degradation of azo dyes has attracted more and more attention. Since it was discovered in the late 1970s that certain bacteria could reductively degrade azo dyes, a variety of bacteria have been found to have this function, among which Pseudomonas, Bacillus and Enterobacteriaceae have the largest number. The reductive degradation of azo dyes by bacteria is mainly through the opening of azo bonds catalyzed by reductases, which is the first and most critical step in the degradation of azo dyes. This type has the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C02F3/34C12R1/19C02F101/38
Inventor 陈杏娟许玫英孙国萍
Owner GUANGDONG INST OF MICROORGANISM